WormBase Tree Display for Variation: WBVar00143019
expand all nodes | collapse all nodes | view schema
| WBVar00143019 | Evidence | Paper_evidence | WBPaper00005152 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| WBPaper00005325 | |||||||||
| Name | Public_name | e185 | |||||||
| Other_name | CE54061:p.Cys185Tyr | ||||||||
| F48E8.1a.1:c.554G>A | |||||||||
| F48E8.1c.1:c.554G>A | |||||||||
| CE01953:p.Cys185Tyr | |||||||||
| F48E8.1b.1:c.554G>A | |||||||||
| CE29046:p.Cys185Tyr | |||||||||
| HGVSg | CHROMOSOME_III:g.5476405G>A | ||||||||
| Sequence_details | SMap | S_parent | Sequence | F48E8 | |||||
| Flanking_sequences | ttgtctgggcaaagacgaatctcgtcggat | cggcttctcccgttgccgtgacgttcaggg | |||||||
| Mapping_target | F48E8 | ||||||||
| Type_of_mutation | Substitution | g | a | ||||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00000255 | ||||||||
| WBStrain00004120 | |||||||||
| WBStrain00004363 | |||||||||
| WBStrain00004381 | |||||||||
| WBStrain00004391 | |||||||||
| WBStrain00006353 | |||||||||
| WBStrain00007327 | |||||||||
| WBStrain00022497 | |||||||||
| WBStrain00022825 | |||||||||
| WBStrain00023552 | |||||||||
| WBStrain00023553 | |||||||||
| WBStrain00023571 | |||||||||
| WBStrain00026731 | |||||||||
| WBStrain00026899 | |||||||||
| WBStrain00027176 | |||||||||
| WBStrain00027177 | |||||||||
| WBStrain00033369 | |||||||||
| Laboratory | CB | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00003055 | |||||||
| Transcript | F48E8.1b.1 | VEP_consequence | missense_variant | ||||||
| VEP_impact | MODERATE | ||||||||
| SIFT | 0 | deleterious | |||||||
| PolyPhen | 1 | probably_damaging | |||||||
| HGVSc | F48E8.1b.1:c.554G>A | ||||||||
| HGVSp | CE29046:p.Cys185Tyr | ||||||||
| cDNA_position | 599 | ||||||||
| CDS_position | 554 | ||||||||
| Protein_position | 185 | ||||||||
| Exon_number | 6/8 | ||||||||
| Codon_change | tGc/tAc | ||||||||
| Amino_acid_change | C/Y | ||||||||
| F48E8.1c.1 | VEP_consequence | missense_variant | |||||||
| VEP_impact | MODERATE | ||||||||
| SIFT | 0 | deleterious | |||||||
| PolyPhen | 1 | probably_damaging | |||||||
| HGVSc | F48E8.1c.1:c.554G>A | ||||||||
| HGVSp | CE54061:p.Cys185Tyr | ||||||||
| cDNA_position | 554 | ||||||||
| CDS_position | 554 | ||||||||
| Protein_position | 185 | ||||||||
| Exon_number | 5/6 | ||||||||
| Codon_change | tGc/tAc | ||||||||
| Amino_acid_change | C/Y | ||||||||
| F48E8.1a.1 | VEP_consequence | missense_variant | |||||||
| VEP_impact | MODERATE | ||||||||
| SIFT | 0 | deleterious | |||||||
| PolyPhen | 1 | probably_damaging | |||||||
| HGVSc | F48E8.1a.1:c.554G>A | ||||||||
| HGVSp | CE01953:p.Cys185Tyr | ||||||||
| cDNA_position | 597 | ||||||||
| CDS_position | 554 | ||||||||
| Protein_position | 185 | ||||||||
| Exon_number | 6/8 | ||||||||
| Codon_change | tGc/tAc | ||||||||
| Amino_acid_change | C/Y | ||||||||
| Interactor | WBInteraction000009116 | ||||||||
| WBInteraction000503035 | |||||||||
| WBInteraction000537301 | |||||||||
| Genetics | Interpolated_map_position | III | -1.62777 | ||||||
| Mapping_data | In_2_point | 276 | |||||||
| 579 | |||||||||
| 2725 | |||||||||
| 3796 | |||||||||
| 3797 | |||||||||
| 5516 | |||||||||
| 6014 | |||||||||
| 7160 | |||||||||
| In_multi_point | 77 | ||||||||
| 90 | |||||||||
| 276 | |||||||||
| 326 | |||||||||
| 355 | |||||||||
| 378 | |||||||||
| 389 | |||||||||
| 407 | |||||||||
| 483 | |||||||||
| 494 | |||||||||
| 496 | |||||||||
| 497 | |||||||||
| 504 | |||||||||
| 507 | |||||||||
| 557 | |||||||||
| 558 | |||||||||
| 559 | |||||||||
| 586 | |||||||||
| 590 | |||||||||
| 755 | |||||||||
| 858 | |||||||||
| 859 | |||||||||
| 867 | |||||||||
| 869 | |||||||||
| 875 | |||||||||
| 876 | |||||||||
| 879 | |||||||||
| 1091 | |||||||||
| 1092 | |||||||||
| 1096 | |||||||||
| 1098 | |||||||||
| 1101 | |||||||||
| 1102 | |||||||||
| 1107 | |||||||||
| 1410 | |||||||||
| 1411 | |||||||||
| 1444 | |||||||||
| 1487 | |||||||||
| 1488 | |||||||||
| 1490 | |||||||||
| 1498 | |||||||||
| 1501 | |||||||||
| 1716 | |||||||||
| 1723 | |||||||||
| 1724 | |||||||||
| 1725 | |||||||||
| 1865 | |||||||||
| 2019 | |||||||||
| 2056 | |||||||||
| 2058 | |||||||||
| 2075 | |||||||||
| 2101 | |||||||||
| 2180 | |||||||||
| 2181 | |||||||||
| 2182 | |||||||||
| 2183 | |||||||||
| 2184 | |||||||||
| 2185 | |||||||||
| 2407 | |||||||||
| 2741 | |||||||||
| 2743 | |||||||||
| 3304 | |||||||||
| In_pos_neg_data | 803 | ||||||||
| 1590 | |||||||||
| Description | Phenotype | WBPhenotype:0000022 | Paper_evidence | WBPaper00000031 | |||||
| WBPaper00000906 | |||||||||
| WBPaper00003454 | |||||||||
| WBPaper00005747 | |||||||||
| Person_evidence | WBPerson261 | ||||||||
| Curator_confirmed | WBPerson48 | ||||||||
| WBPerson712 | |||||||||
| WBPerson2987 | |||||||||
| Remark | about 50% longer than wildtype at all stages, markedly tapering tail and head | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Table 1 | Paper_evidence | WBPaper00005747 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Recessive | Paper_evidence | WBPaper00000906 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000342 | Person_evidence | WBPerson261 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Male bursa elongated. | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000370 | Paper_evidence | WBPaper00053410 | |||||||
| Person_evidence | WBPerson261 | ||||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPerson3569 | |||||||||
| Remark | Eggs elongated. | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Figure 2, S1 | Paper_evidence | WBPaper00053410 | |||||||
| Curator_confirmed | WBPerson3569 | ||||||||
| WBPhenotype:0000961 | Paper_evidence | WBPaper00005747 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | Table 1 | Paper_evidence | WBPaper00005747 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0001412 | Paper_evidence | WBPaper00005747 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | Authors report "multiple or discontinuous ala" (Table 1) | Paper_evidence | WBPaper00005747 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0001517 | Paper_evidence | WBPaper00005747 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | Authors report "abnormal branched annuli (lateral hypodermis)" and "wide annuli" (Table 1) | Paper_evidence | WBPaper00005747 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0002117 | Person_evidence | WBPerson261 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | low penetrance tendency to form constriction behind head, may result in auto-decapitation | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_not_observed | WBPhenotype:0000505 | Paper_evidence | WBPaper00001328 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Males are not Ram. | Paper_evidence | WBPaper00001328 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0006941 | PATO:0000460 | Paper_evidence | WBPaper00001328 | ||||
| Curator_confirmed | WBPerson712 | ||||||||
| Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001328 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00001328 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001184 | Paper_evidence | WBPaper00032966 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | Abnormally sized mutants did not display enhanced fat accumulation | Paper_evidence | WBPaper00032966 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_assay | Treatment | Nile Red staining | Paper_evidence | WBPaper00032966 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Reference | WBPaper00032966 | ||||||||
| WBPaper00001328 | |||||||||
| WBPaper00000031 | |||||||||
| WBPaper00005747 | |||||||||
| WBPaper00003454 | |||||||||
| WBPaper00021761 | |||||||||
| WBPaper00014080 | |||||||||
| WBPaper00000906 | |||||||||
| WBPaper00024401 | |||||||||
| WBPaper00010119 | |||||||||
| WBPaper00053410 | |||||||||
| WBPaper00061175 | |||||||||
| Remark | Variation stub/paper connection generated from the May 2021 NN VFP dataset. | ||||||||
| Created by WBPerson51134 from the NN_VFP_triage_pipeline | |||||||||
| Method | Substitution_allele |
