WormBase Tree Display for Variation: WBVar00143019
expand all nodes | collapse all nodes | view schema
WBVar00143019 | Evidence | Paper_evidence | WBPaper00005152 | |||
---|---|---|---|---|---|---|
WBPaper00005325 | ||||||
Name | Public_name | e185 | ||||
Other_name | CE54061:p.Cys185Tyr | |||||
F48E8.1a.1:c.554G>A | ||||||
F48E8.1c.1:c.554G>A | ||||||
CE01953:p.Cys185Tyr | ||||||
F48E8.1b.1:c.554G>A | ||||||
CE29046:p.Cys185Tyr | ||||||
HGVSg | CHROMOSOME_III:g.5476405G>A | |||||
Sequence_details | SMap | S_parent | Sequence | F48E8 | ||
Flanking_sequences | ttgtctgggcaaagacgaatctcgtcggat | cggcttctcccgttgccgtgacgttcaggg | ||||
Mapping_target | F48E8 | |||||
Type_of_mutation | Substitution | g | a | |||
SeqStatus | Sequenced | |||||
Variation_type | Allele | |||||
Origin | Species | Caenorhabditis elegans | ||||
Strain (17) | ||||||
Laboratory | CB | |||||
Status | Live | |||||
Affects | Gene | WBGene00003055 | ||||
Transcript | F48E8.1b.1 | VEP_consequence | missense_variant | |||
VEP_impact | MODERATE | |||||
SIFT | 0 | deleterious | ||||
PolyPhen | 1 | probably_damaging | ||||
HGVSc | F48E8.1b.1:c.554G>A | |||||
HGVSp | CE29046:p.Cys185Tyr | |||||
cDNA_position | 599 | |||||
CDS_position | 554 | |||||
Protein_position | 185 | |||||
Exon_number | 6/8 | |||||
Codon_change | tGc/tAc | |||||
Amino_acid_change | C/Y | |||||
F48E8.1c.1 (12) | ||||||
F48E8.1a.1 (12) | ||||||
Interactor | WBInteraction000009116 | |||||
WBInteraction000503035 | ||||||
WBInteraction000537301 | ||||||
Genetics | Interpolated_map_position | III | -1.62777 | |||
Mapping_data | In_2_point | 276 | ||||
579 | ||||||
2725 | ||||||
3796 | ||||||
3797 | ||||||
5516 | ||||||
6014 | ||||||
7160 | ||||||
In_multi_point (62) | ||||||
In_pos_neg_data | 803 | |||||
1590 | ||||||
Description | Phenotype (7) | |||||
Phenotype_not_observed (2) | ||||||
Reference (12) | ||||||
Remark | Variation stub/paper connection generated from the May 2021 NN VFP dataset. | |||||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | ||||||
Method | Substitution_allele |