WormBase Tree Display for Variation: WBVar00143061
expand all nodes | collapse all nodes | view schema
WBVar00143061 | Evidence | Paper_evidence | WBPaper00004985 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e245 | |||||||
Other_name | ZC416.8a.1:c.1039G>C | ||||||||
ZC416.8b.1:c.1-1285G>C | |||||||||
CE17307:p.Gly347Arg | |||||||||
HGVSg | CHROMOSOME_IV:g.3619060C>G | ||||||||
Sequence_details | SMap | S_parent | Sequence | ZC416 | |||||
Flanking_sequences | gcgattgctatggttgggttggctatggag | gaatcgcgtgttttgcaatcccctatacca | |||||||
Mapping_target | ZC416 | ||||||||
Type_of_mutation | Substitution | g | m | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (17) | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006756 | |||||||
WBGene00000481 | |||||||||
Transcript | ZC416.8a.1 (12) | ||||||||
ZC416.8b.1 | VEP_consequence | intron_variant | |||||||
VEP_impact | MODIFIER | ||||||||
HGVSc | ZC416.8b.1:c.1-1285G>C | ||||||||
Intron_number | 1/11 | ||||||||
Interactor | WBInteraction000518365 | ||||||||
WBInteraction000518556 | |||||||||
WBInteraction000518559 | |||||||||
WBInteraction000518561 | |||||||||
WBInteraction000518851 | |||||||||
WBInteraction000518855 | |||||||||
WBInteraction000519040 | |||||||||
WBInteraction000519045 | |||||||||
WBInteraction000519046 | |||||||||
Genetics | Interpolated_map_position | IV | -3.11559 | ||||||
Mapping_data | In_2_point | 103 | |||||||
728 | |||||||||
1646 | |||||||||
1647 | |||||||||
2757 | |||||||||
In_multi_point | 96 | ||||||||
101 | |||||||||
104 | |||||||||
275 | |||||||||
455 | |||||||||
456 | |||||||||
457 | |||||||||
458 | |||||||||
459 | |||||||||
460 | |||||||||
461 | |||||||||
462 | |||||||||
463 | |||||||||
464 | |||||||||
465 | |||||||||
466 | |||||||||
596 | |||||||||
610 | |||||||||
623 | |||||||||
684 | |||||||||
691 | |||||||||
742 | |||||||||
900 | |||||||||
901 | |||||||||
904 | |||||||||
1127 | |||||||||
1132 | |||||||||
1517 | |||||||||
1523 | |||||||||
3063 | |||||||||
3132 | |||||||||
5675 | |||||||||
Description | Phenotype | WBPhenotype:0000017 | Paper_evidence | WBPaper00006029 | |||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals remained resistant to aldicarb at 15C and 25C. | Paper_evidence | WBPaper00006029 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Ric | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003650 | Paper_evidence | WBPaper00006029 | |||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were monitored for paralysis over time in the presence of 1mM alicarb. | Paper_evidence | WBPaper00006029 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 15, 25 | Paper_evidence | WBPaper00006029 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000020 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | slow irregular pumping | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000039 | Paper_evidence | WBPaper00040570 | |||||||
Curator_confirmed | WBPerson8126 | ||||||||
Remark | Fig. 3 Reduction in lifespan upon reserpine treatment, opposite to what is seen in wild type animals | Paper_evidence | WBPaper00040570 | ||||||
Curator_confirmed | WBPerson8126 | ||||||||
Affected_by | Molecule | WBMol:00002955 | Paper_evidence | WBPaper00040570 | |||||
Curator_confirmed | WBPerson8126 | ||||||||
WBPhenotype:0000059 | Paper_evidence | WBPaper00041267 | |||||||
Curator_confirmed | WBPerson264 | ||||||||
Remark | larval arrest in liquid medium (CeMM) | Paper_evidence | WBPaper00041267 | ||||||
Curator_confirmed | WBPerson264 | ||||||||
WBPhenotype:0000061 | Paper_evidence | WBPaper00041267 | |||||||
Curator_confirmed | WBPerson264 | ||||||||
WBPhenotype:0000131 | Paper_evidence | WBPaper00041267 | |||||||
Curator_confirmed | WBPerson264 | ||||||||
Remark | suppressed pheromene-induced dauer formation | Paper_evidence | WBPaper00041267 | ||||||
Curator_confirmed | WBPerson264 | ||||||||
WBPhenotype:0000164 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | rather thin | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000229 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | rather small | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000384 | Paper_evidence | WBPaper00040041 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibit AVM ventral axon guidance defects. DD and VD neurons migrate normally in these mutants and are unaffected by exogenous acetylcholine. | Paper_evidence | WBPaper00040041 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00004765 | Paper_evidence | WBPaper00040041 | |||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003832 | PATO:0000460 | Paper_evidence | WBPaper00040041 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000565 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | severe coiler at all stages | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001285 | Paper_evidence | WBPaper00045312 | |||||||
Curator_confirmed | WBPerson15087 | ||||||||
WBPhenotype:0001296 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | resistant to 0.1 mM lannate | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00002700 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001645 | Paper_evidence | WBPaper00004117 | |||||||
Curator_confirmed | WBPerson1754 | ||||||||
Remark | Increased levels of protein degradation in muscle in response to starvation | Paper_evidence | WBPaper00004117 | ||||||
Curator_confirmed | WBPerson1754 | ||||||||
WBPhenotype:0002256 | Paper_evidence | WBPaper00041069 | |||||||
Curator_confirmed | WBPerson1754 | ||||||||
Remark | Increased sensitivity to movement decline in response to selenium exposure | Paper_evidence | WBPaper00041069 | ||||||
Curator_confirmed | WBPerson1754 | ||||||||
Affected_by | Molecule | WBMol:00001915 | Paper_evidence | WBPaper00041069 | |||||
Curator_confirmed | WBPerson1754 | ||||||||
Phenotype_not_observed | WBPhenotype:0000123 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | normal ChAT (choline acetyltransferase) levels | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000631 | Paper_evidence | WBPaper00035198 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals do not exhibit anterior convulsions when treated with pentylenetetrazole(PTZ). | Paper_evidence | WBPaper00035198 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00004251 | Paper_evidence | WBPaper00035198 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001645 | Paper_evidence | WBPaper00040284 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table S2 | Paper_evidence | WBPaper00040284 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001853 | Paper_evidence | WBPaper00035150 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutant response to AAD 1470 was comparable to that observed in wild-type | Paper_evidence | WBPaper00035150 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference (22) | |||||||||
Remark | Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006756 Missense 347 G to R | ||||||||
Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00000481 Intron Inferred_automatically map_Alleles.pl | |||||||||
Method | Substitution_allele |