WormBase Tree Display for Variation: WBVar00143019
expand all nodes | collapse all nodes | view schema
WBVar00143019 | Evidence | Paper_evidence | WBPaper00005152 | ||
---|---|---|---|---|---|
WBPaper00005325 | |||||
Name | Public_name | e185 | |||
Other_name | CE54061:p.Cys185Tyr | ||||
F48E8.1a.1:c.554G>A | |||||
F48E8.1c.1:c.554G>A | |||||
CE01953:p.Cys185Tyr | |||||
F48E8.1b.1:c.554G>A | |||||
CE29046:p.Cys185Tyr | |||||
HGVSg | CHROMOSOME_III:g.5476405G>A | ||||
Sequence_details | SMap | S_parent | Sequence | F48E8 | |
Flanking_sequences | ttgtctgggcaaagacgaatctcgtcggat | cggcttctcccgttgccgtgacgttcaggg | |||
Mapping_target | F48E8 | ||||
Type_of_mutation | Substitution | g | a | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain (17) | |||||
Laboratory | CB | ||||
Status | Live | ||||
Affects (3) | |||||
Genetics | Interpolated_map_position | III | -1.62777 | ||
Mapping_data | In_2_point | 276 | |||
579 | |||||
2725 | |||||
3796 | |||||
3797 | |||||
5516 | |||||
6014 | |||||
7160 | |||||
In_multi_point | 77 | ||||
90 | |||||
276 | |||||
326 | |||||
355 | |||||
378 | |||||
389 | |||||
407 | |||||
483 | |||||
494 | |||||
496 | |||||
497 | |||||
504 | |||||
507 | |||||
557 | |||||
558 | |||||
559 | |||||
586 | |||||
590 | |||||
755 | |||||
858 | |||||
859 | |||||
867 | |||||
869 | |||||
875 | |||||
876 | |||||
879 | |||||
1091 | |||||
1092 | |||||
1096 | |||||
1098 | |||||
1101 | |||||
1102 | |||||
1107 | |||||
1410 | |||||
1411 | |||||
1444 | |||||
1487 | |||||
1488 | |||||
1490 | |||||
1498 | |||||
1501 | |||||
1716 | |||||
1723 | |||||
1724 | |||||
1725 | |||||
1865 | |||||
2019 | |||||
2056 | |||||
2058 | |||||
2075 | |||||
2101 | |||||
2180 | |||||
2181 | |||||
2182 | |||||
2183 | |||||
2184 | |||||
2185 | |||||
2407 | |||||
2741 | |||||
2743 | |||||
3304 | |||||
In_pos_neg_data | 803 | ||||
1590 | |||||
Description (2) | |||||
Reference (12) | |||||
Remark | Variation stub/paper connection generated from the May 2021 NN VFP dataset. | ||||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | |||||
Method | Substitution_allele |