WormBase Tree Display for Variation: WBVar00143019
expand all nodes | collapse all nodes | view schema
WBVar00143019 | Evidence | Paper_evidence | WBPaper00005152 | |||||
---|---|---|---|---|---|---|---|---|
WBPaper00005325 | ||||||||
Name | Public_name | e185 | ||||||
Other_name | CE54061:p.Cys185Tyr | |||||||
F48E8.1a.1:c.554G>A | ||||||||
F48E8.1c.1:c.554G>A | ||||||||
CE01953:p.Cys185Tyr | ||||||||
F48E8.1b.1:c.554G>A | ||||||||
CE29046:p.Cys185Tyr | ||||||||
HGVSg | CHROMOSOME_III:g.5476405G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | F48E8 | ||||
Flanking_sequences | ttgtctgggcaaagacgaatctcgtcggat | cggcttctcccgttgccgtgacgttcaggg | ||||||
Mapping_target | F48E8 | |||||||
Type_of_mutation | Substitution | g | a | |||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain (17) | ||||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00003055 | ||||||
Transcript | F48E8.1b.1 (12) | |||||||
F48E8.1c.1 (12) | ||||||||
F48E8.1a.1 (12) | ||||||||
Interactor | WBInteraction000009116 | |||||||
WBInteraction000503035 | ||||||||
WBInteraction000537301 | ||||||||
Genetics | Interpolated_map_position | III | -1.62777 | |||||
Mapping_data | In_2_point | 276 | ||||||
579 | ||||||||
2725 | ||||||||
3796 | ||||||||
3797 | ||||||||
5516 | ||||||||
6014 | ||||||||
7160 | ||||||||
In_multi_point | 77 | |||||||
90 | ||||||||
276 | ||||||||
326 | ||||||||
355 | ||||||||
378 | ||||||||
389 | ||||||||
407 | ||||||||
483 | ||||||||
494 | ||||||||
496 | ||||||||
497 | ||||||||
504 | ||||||||
507 | ||||||||
557 | ||||||||
558 | ||||||||
559 | ||||||||
586 | ||||||||
590 | ||||||||
755 | ||||||||
858 | ||||||||
859 | ||||||||
867 | ||||||||
869 | ||||||||
875 | ||||||||
876 | ||||||||
879 | ||||||||
1091 | ||||||||
1092 | ||||||||
1096 | ||||||||
1098 | ||||||||
1101 | ||||||||
1102 | ||||||||
1107 | ||||||||
1410 | ||||||||
1411 | ||||||||
1444 | ||||||||
1487 | ||||||||
1488 | ||||||||
1490 | ||||||||
1498 | ||||||||
1501 | ||||||||
1716 | ||||||||
1723 | ||||||||
1724 | ||||||||
1725 | ||||||||
1865 | ||||||||
2019 | ||||||||
2056 | ||||||||
2058 | ||||||||
2075 | ||||||||
2101 | ||||||||
2180 | ||||||||
2181 | ||||||||
2182 | ||||||||
2183 | ||||||||
2184 | ||||||||
2185 | ||||||||
2407 | ||||||||
2741 | ||||||||
2743 | ||||||||
3304 | ||||||||
In_pos_neg_data | 803 | |||||||
1590 | ||||||||
Description | Phenotype | WBPhenotype:0000022 | Paper_evidence | WBPaper00000031 | ||||
WBPaper00000906 | ||||||||
WBPaper00003454 | ||||||||
WBPaper00005747 | ||||||||
Person_evidence | WBPerson261 | |||||||
Curator_confirmed (3) | ||||||||
Remark | about 50% longer than wildtype at all stages, markedly tapering tail and head | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Table 1 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Recessive | Paper_evidence | WBPaper00000906 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000342 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Male bursa elongated. | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000370 | Paper_evidence | WBPaper00053410 | ||||||
Person_evidence | WBPerson261 | |||||||
Curator_confirmed (2) | ||||||||
Remark | Eggs elongated. | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Figure 2, S1 | Paper_evidence | WBPaper00053410 | ||||||
Curator_confirmed | WBPerson3569 | |||||||
WBPhenotype:0000961 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Table 1 | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001412 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Authors report "multiple or discontinuous ala" (Table 1) | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001517 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Authors report "abnormal branched annuli (lateral hypodermis)" and "wide annuli" (Table 1) | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002117 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | low penetrance tendency to form constriction behind head, may result in auto-decapitation | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed (2) | ||||||||
Reference (12) | ||||||||
Remark | Variation stub/paper connection generated from the May 2021 NN VFP dataset. | |||||||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | ||||||||
Method | Substitution_allele |