"To confirm that the autophagy pathway was not a major means of CPL-1(W32A;Y35A)::YFP disposal, we crossed Pnhx-2::cpl-1(W32A;Y35A)::YFP animals with an unc-51(e369) knockout strain to yield unc-51(e369);P-nhx-2::CPL-1(W32A;Y35A)::YFP; Pmyo-2::mCherry animals. Two independent lines were analyzed, and showed no significant differences in the level of CPL-1(W32A;Y35A)::YFP, as compared to the controls (Figure 6B)."
e369 is a coupled mutation. In addition to the curated lesion there is a CAG to TAG substitution with flanking sequences agccgacgattcatgagaatgagccgttgg taatgcaaagtatcagcagacggatgttaa