WormBase Tree Display for Variation: WBVar00241454
expand all nodes | collapse all nodes | view schema
WBVar00241454 | Evidence | Paper_evidence | WBPaper00018906 | ||||||
---|---|---|---|---|---|---|---|---|---|
Person_evidence | WBPerson453 | ||||||||
Name | Public_name | r1162 | |||||||
Other_name | K11C4.5d.1:c.11914-206_14897-3del | ||||||||
K11C4.5l.1:c.11908-206_14891-3del | |||||||||
K11C4.5f.1:c.11959-206_14942-3del | |||||||||
K11C4.5c.1:c.12262-206_15245-3del | |||||||||
K11C4.5a.1:c.12304-206_15287-3del | |||||||||
K11C4.5b.1:c.11956-206_14939-3del | |||||||||
K11C4.5o.1:c.12259-206_15242-3del | |||||||||
K11C4.5k.1:c.12256-206_15239-3del | |||||||||
K11C4.5i.1:c.12298-206_15281-3del | |||||||||
K11C4.5m.1:c.12301-206_15284-3del | |||||||||
K11C4.5e.1:c.12307-206_15290-3del | |||||||||
K11C4.5g.1:c.12265-206_15248-3del | |||||||||
K11C4.5p.1:c.11911-206_14894-3del | |||||||||
K11C4.5j.1:c.11950-206_14933-3del | |||||||||
K11C4.5n.1:c.11953-206_14936-3del | |||||||||
K11C4.5h.1:c.11917-206_14900-3del | |||||||||
HGVSg | CHROMOSOME_V:g.6902386_6906045del | ||||||||
Sequence_details | SMap | S_parent | Sequence | K11C4 | |||||
Flanking_sequences | agctctccgaaagcgtcgatgatcaaacct | aaaaaaaaactataaaattcaagcaaatca | |||||||
Mapping_target | K11C4 | ||||||||
Type_of_mutation | Deletion | ||||||||
SeqStatus | Pending_curation | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (6) | |||||||||
Laboratory | TR | ||||||||
EN | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006801 | |||||||
Transcript (16) | |||||||||
Interactor | WBInteraction000519345 | ||||||||
Isolation | Mutagen | Tc1 | |||||||
Genetics | Interpolated_map_position | V | 0.459264 | ||||||
Description | Phenotype | WBPhenotype:0000002 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | weak kinker, resembles e540 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000164 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | resembles e540 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000561 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | head region but not body resistant to 1 mM levamisole, resembles e540 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00004019 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005739 | PATO:0000460 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000563 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | slight shrinker, resembles e540 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000646 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | resembles e540 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001599 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | head region but not body resistant to ouabain, resembles e540 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00001924 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005739 | PATO:0000460 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0001645 | Paper_evidence | WBPaper00040284 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table S2 | Paper_evidence | WBPaper00040284 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference | WBPaper00040284 | ||||||||
WBPaper00018906 | |||||||||
WBPaper00066013 | |||||||||
Remark | Variation information submitted by WBPerson453 on 2022-11-17_09:04:46 via the Allele submission form. Submitted data refers to the negative strand. | Curator_confirmed | WBPerson51134 | ||||||
Submitted comments: Mutation starts and ends in introns, the theoretical spliced mRNA has a frameshift and has a STOP codon after the protein sequenceFERQIKNVDAHGANELLLRHLSSKIRHRSRQDRLGAQ, 30 bp upstream: AAGgtacccacagacactgtagttttgtgtttgattcggttgcgttccacatctaatctattaaaattctcaaactctccaatagattgtgaataacccaacacccccttctaacccctaaaccaatttgcagAACGTTGACGCCCATGGCGCAAACGAACTGCTCTTACGTCACCTCTCATCGAAAATTCGACATCGATCCCGGCAAGATCGCCTCGGCGCACAGgtttcgagcccgcatattatctctatcaactgtcttttttcgcctgatttgcttgaattttatagttttttttt, 30 bp downstream: agGTTTGATCATCGACGCTTTCGGAGAGCTTCGTGATCAACAAGAATCTGCAACTGAGAAGCTCGAGTCATCATGTTTCATTTGCGACATCGGCAAAGAAACGTTTGATCGGATGCCTCGAGGCTTCGAAATTCACACCACCAAAGAGCACAACTTTGCCAATTACCTgtatgttaaatgcttttattcaactgttctaacttttcaaacttctagGTTCTTCTTACAACATCTGGTCAACAAAGACGAAACAGAGTACACTGGTCAAGAAACGTACGTACGTGAGAAGTACGATAATCG We obtained this strain from the CGC and sequenced the deletion. | Person_evidence | WBPerson453 | |||||||
Curator_confirmed | WBPerson51134 | ||||||||
Method | Deletion_allele |