WormBase Tree Display for Variation: WBVar00143070
expand all nodes | collapse all nodes | view schema
WBVar00143070 | Evidence | Paper_evidence | WBPaper00004453 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e261 | |||||||
Other_name | W09C5.2.1:c.85G>A | ||||||||
CE20165:p.Gly29Arg | |||||||||
HGVSg | CHROMOSOME_I:g.13629317G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | W09C5 | |||||
Flanking_sequences | gggcagcacaaagaaaatccgaattactgg | gattcgccaacttcccgaatcaagtcttcc | |||||||
Mapping_target | W09C5 | ||||||||
Type_of_mutation | Substitution | g | a | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004137 | ||||||||
WBStrain00005472 | |||||||||
WBStrain00008449 | |||||||||
WBStrain00023968 | |||||||||
WBStrain00027078 | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006793 | |||||||
Transcript | W09C5.2.1 | VEP_consequence | missense_variant | ||||||
VEP_impact | MODERATE | ||||||||
SIFT | 0 | deleterious | |||||||
PolyPhen | 1 | probably_damaging | |||||||
HGVSc | W09C5.2.1:c.85G>A | ||||||||
HGVSp | CE20165:p.Gly29Arg | ||||||||
cDNA_position | 91 | ||||||||
CDS_position | 85 | ||||||||
Protein_position | 29 | ||||||||
Exon_number | 2/7 | ||||||||
Codon_change | Gga/Aga | ||||||||
Amino_acid_change | G/R | ||||||||
Interactor | WBInteraction000501463 | ||||||||
Genetics | Interpolated_map_position | I | 21.6133 | ||||||
Mapping_data | In_2_point | 24 | |||||||
In_multi_point | 44 | ||||||||
249 | |||||||||
1227 | |||||||||
1449 | |||||||||
1696 | |||||||||
1697 | |||||||||
1703 | |||||||||
2769 | |||||||||
Marked_rearrangement | hT2[dpy-18(h662) unc-59(e261)] | ||||||||
Description | Phenotype | WBPhenotype:0000002 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | all phenotypes similar to or slightly stronger than those of unc-85(e1414) | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000070 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | males have very abnormal tail anatomy | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES2_Difficult_to_score (2) | ||||||||
WBPhenotype:0000164 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | thin | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000604 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | variable defects in neuroanatomy | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00000031 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000695 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | vulva variably abnormal, often protrusive, sometimes ruptured | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000746 | Paper_evidence | WBPaper00057125 | |||||||
Curator_confirmed | WBPerson7492 | ||||||||
Remark | delayed abscission | Paper_evidence | WBPaper00057125 | ||||||
Curator_confirmed | WBPerson7492 | ||||||||
EQ_annotations | GO_term | GO:0061952 | PATO:0000502 | Paper_evidence | WBPaper00057125 | ||||
Curator_confirmed | WBPerson7492 | ||||||||
WBPhenotype:0000825 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | many postembryonic lineage abnormalities resulting from variable failures in cytokinesis; gonad lineages sometimes defective | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
all phenotypes similar to or slightly stronger than those of unc-85(e1414) | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000885 | Paper_evidence | WBPaper00050047 | |||||||
Curator_confirmed | WBPerson7492 | ||||||||
Remark | phagocytosis of midbodies delayed | Paper_evidence | WBPaper00050047 | ||||||
Curator_confirmed | WBPerson7492 | ||||||||
Phenotype_assay | Genotype | unc-59(RNAi) | Paper_evidence | WBPaper00050047 | |||||
Curator_confirmed | WBPerson7492 | ||||||||
WBPhenotype:0001005 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | poor backward movement, forward better; thin; vulva variably abnormal, often protrusive, sometimes ruptured; many postembryonic lineage abnormalities resulting from variable failures in cytokinesis; gonad lineages sometimes defective; variable defects in neuroanatomy; males have very abnormal tail anatomy. ES2 ME0 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
all phenotypes similar to or slightly stronger than those of unc-85(e1414) | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001018 | Paper_evidence | WBPaper00050047 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson7492 | |||||||||
Remark | all phenotypes similar to or slightly stronger than those of unc-85(e1414) | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
abscission delayed | Paper_evidence | WBPaper00050047 | |||||||
Curator_confirmed | WBPerson7492 | ||||||||
Phenotype_assay | Genotype | unc-59(RNAi) | Paper_evidence | WBPaper00050047 | |||||
Curator_confirmed | WBPerson7492 | ||||||||
Reference | WBPaper00014470 | ||||||||
WBPaper00029020 | |||||||||
WBPaper00000031 | |||||||||
WBPaper00022590 | |||||||||
WBPaper00012627 | |||||||||
WBPaper00050047 | |||||||||
WBPaper00057125 | |||||||||
Method | Substitution_allele |