WormBase Tree Display for Variation: WBVar00143034
expand all nodes | collapse all nodes | view schema
WBVar00143034 | Evidence | Paper_evidence | WBPaper00026866 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e204 | |||||||
Other_name | Y37E11C.1b.1:c.640G>A | ||||||||
Y37E11C.1c.1:c.172G>A | |||||||||
CE31638:p.Asp214Asn | |||||||||
CE31639:p.Asp58Asn | |||||||||
CE21557:p.Asp389Asn | |||||||||
Y37E11C.1a.1:c.1165G>A | |||||||||
HGVSg | CHROMOSOME_IV:g.3523049G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | M57 | |||||
Flanking_sequences | gcgggaaagctcgcccttcccgccggaatc | atgtctacactcaggtcaccgattcttccg | |||||||
Mapping_target | M57 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00026866 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (13) | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006769 | |||||||
Transcript (3) | |||||||||
Interactor | WBInteraction000569521 | ||||||||
Genetics | Interpolated_map_position | IV | -3.30051 | ||||||
Mapping_data | In_2_point | 99 | |||||||
448 | |||||||||
484 | |||||||||
1643 | |||||||||
3276 | |||||||||
In_multi_point (13) | |||||||||
Description | Phenotype | WBPhenotype:0000180 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | amphid, phasmid, PDE, PVP axons abnormal | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term (4) | ||||||||
WBPhenotype:0000181 | Paper_evidence | WBPaper00001105 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | HSN axons are posteriorly misdirected and never reach the nerve ring | Paper_evidence | WBPaper00001105 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Low | Paper_evidence | WBPaper00001105 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Range | 9 | 9 | Paper_evidence | WBPaper00001105 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00001105 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001105 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000583 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | dumpyish | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00001105 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000644 | Paper_evidence | WBPaper00000031 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000646 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | very slow | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000880 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | multiple defects in axonogenesis | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001224 | Paper_evidence | WBPaper00001105 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | HSN axons show ventral blocks (failure to extend ventrally from their cell bodies to the ventral cord) and anterior blocks (axons enter the ventral cord normally but fail to complete the anterior growth towards the nerve ring) | Paper_evidence | WBPaper00001105 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Incomplete | 20 percent of mutants have ventral blocks and 62 percent have anterior blocks | Paper_evidence | WBPaper00001105 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00001105 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001105 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001329 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | tends to curl | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001588 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | abnormally abundant neuronal microtubules | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003679 | PATO:0000460 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001661 | Paper_evidence | WBPaper00003760 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | AWC specific str-2 expression Is altered: str-2 was expressed in either 0, 1, or 2 AWC cells in mutants | Paper_evidence | WBPaper00003760 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005672 | PATO:0000460 | Paper_evidence | WBPaper00003760 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0002521 | Paper_evidence | WBPaper00049389 | |||||||
Curator_confirmed | WBPerson30255 | ||||||||
EQ_annotations | GO_term | GO:0005921 | PATO:0000470 | Paper_evidence | WBPaper00049389 | ||||
Curator_confirmed | WBPerson30255 | ||||||||
WBPhenotype:0002535 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | weak FITC uptake | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000351 | Paper_evidence | WBPaper00060038 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "As expected for a negative control, the empty feeding vector (L4440) fed to either wildtype or unc-33(e204) homozygous animals showed a low level of lethality, 3.4% and 9.3% on average, respectively. These data were not significantly different from each other in a pairwise comparison (p=0.872)." | Paper_evidence | WBPaper00060038 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Strain | WBStrain00004126 | Paper_evidence | WBPaper00060038 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00060038 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000436 | Paper_evidence | WBPaper00040857 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutants showed normal localization of SNB-1::VENUS in the RIA neuron. | Paper_evidence | WBPaper00040857 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000679 | Paper_evidence | WBPaper00028448 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | PKD-2::GFP localization is not different from wild type. | Paper_evidence | WBPaper00028448 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | No disruption of ASE asymmetry (as seen with lim-6 and gcy-7 reporters) | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | otIs114, otIs6, otIs3 | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference (14) | |||||||||
Method | Substitution_allele |