WormBase Tree Display for Variation: WBVar00143154
expand all nodes | collapse all nodes | view schema
WBVar00143154 | Evidence | Paper_evidence | WBPaper00002050 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e369 | |||||||
Other_name | Y60A3A.1.1:c.-2G>A | ||||||||
HGVSg | CHROMOSOME_V:g.20004422C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y60A3A | |||||
Flanking_sequences | atagtcacacaataatcacccaacccagct | aatggagcagtttgacggcttcgagtacag | |||||||
Mapping_target | Y60A3A | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00002050 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (21) | |||||||||
Laboratory | CB | ||||||||
DCD | |||||||||
Status | Live | ||||||||
Affects (3) | |||||||||
Genetics | Interpolated_map_position | V | 24.4355 | ||||||
Mapping_data | In_2_point | 137 | |||||||
254 | |||||||||
849 | |||||||||
3379 | |||||||||
3380 | |||||||||
6116 | |||||||||
6128 | |||||||||
7012 | |||||||||
7165 | |||||||||
In_multi_point (22) | |||||||||
In_pos_neg_data | 298 | ||||||||
2143 | |||||||||
Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00002050 | |||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000140 | Paper_evidence | WBPaper00041209 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | exacerbated L3 arrest compared with wild-type at 72 and 96 h | Paper_evidence | WBPaper00041209 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003513 | Paper_evidence | WBPaper00041209 | |||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000035 | PATO:0000460 | Paper_evidence | WBPaper00041209 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | serial ultraviolet C radiation(UVC) exposure (10 J/m2) | Paper_evidence | WBPaper00041209 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000181 | Paper_evidence | WBPaper00001105 | |||||||
WBPaper00031671 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | HSN axons are posteriorly misdirected and never reach the nerve ring | Paper_evidence | WBPaper00001105 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
In unc-51 mutatns, 29% of the NSM neurons lack a dorsal process while 38% have defects in the termination of the dorsal or subventral process along the anterior-posterior axis | Paper_evidence | WBPaper00031671 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance (2) | |||||||||
EQ_annotations | Anatomy_term | WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00001105 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0003666 | PATO:0000460 | Paper_evidence | WBPaper00031671 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001105 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | zdIs13 [ tph-1p::GFP] | Paper_evidence | WBPaper00031671 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000274 | Paper_evidence | WBPaper00038332 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 10-20% dead eggs. | Paper_evidence | WBPaper00038332 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000457 | Paper_evidence | WBPaper00055078 | |||||||
Curator_confirmed | WBPerson14703 | ||||||||
Remark | Reduced L1 starvation survival | Paper_evidence | WBPaper00055078 | ||||||
Curator_confirmed | WBPerson14703 | ||||||||
EQ_annotations | Life_stage | WBls:0000802 | PATO:0000460 | Paper_evidence | WBPaper00055078 | ||||
Curator_confirmed | WBPerson14703 | ||||||||
GO_term | GO:0042594 | PATO:0000460 | Paper_evidence | WBPaper00055078 | |||||
Curator_confirmed | WBPerson14703 | ||||||||
WBPhenotype:0000572 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | dorsal extensions of DD and VD neurons grow in aberrant directions fail to connect to dorsal nerve cord | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005270 | PATO:0000460 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005303 | PATO:0000460 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000583 | Paper_evidence | WBPaper00002050 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson712 | |||||||||
Remark | dumpy | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000640 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Egl | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00001105 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000644 | Paper_evidence | WBPaper00002050 | |||||||
WBPaper00000031 | |||||||||
WBPaper00038332 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson712 | |||||||||
Remark | lf mutations in unc-51 led to paralyzed adults | Paper_evidence | WBPaper00038332 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
paralysed | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000736 | Paper_evidence | WBPaper00040312 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Induction of autophagosome membrane marker GFP-LGG-1-positive puncta at the 1-cell stage was strongly inhibited. Retardation of the disappearance of paternal mitochondria was observed when mutant hermaphrodites were mated with wild-type males. | Paper_evidence | WBPaper00040312 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Maternal | With_maternal_effect | Paper_evidence | WBPaper00040312 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000880 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Amphid, phasmid, PDE and other axons abnormal; multiple defects in axon elongation, fasciculation, etc. Abnormal axon ultrastructure: varicosities, cisternae, abnormal vesicles. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005394 | PATO:0000460 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0006753 | PATO:0000460 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0006747 | PATO:0000460 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000885 | Paper_evidence | WBPaper00041694 | |||||||
Curator_confirmed | WBPerson2798 | ||||||||
Remark | delayed engulfment of apoptotic corpses during embryogenesis | Paper_evidence | WBPaper00041694 | ||||||
Curator_confirmed | WBPerson2798 | ||||||||
WBPhenotype:0001135 | Paper_evidence | WBPaper00040312 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Paternal mitochondria persisted. | Paper_evidence | WBPaper00040312 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Maternal | With_maternal_effect | Paper_evidence | WBPaper00040312 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001224 | Paper_evidence | WBPaper00001105 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | HSN axons show ventral blocks (failure to extend ventrally from their cell bodies to the ventral cord) and anterior blocks (axons enter the ventral cord normally but fail to complete the anterior growth towards the nerve ring) | Paper_evidence | WBPaper00001105 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Incomplete | 1 percent of mutants have ventral blocks and 97 percent have anterior blocks | Paper_evidence | WBPaper00001105 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00001105 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001105 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001227 | Paper_evidence | WBPaper00027335 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | Ray commissures absent: R1, R2/3, R4/5. | Paper_evidence | WBPaper00027335 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0001329 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | tends to curl | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001375 | Paper_evidence | WBPaper00040312 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Induction of GFP-LGG-1-positive puncta at the 1-cell stage was strongly inhibited. | Paper_evidence | WBPaper00040312 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002267 | Paper_evidence | WBPaper00055078 | |||||||
Curator_confirmed | WBPerson14703 | ||||||||
Remark | Mutants fail to deplete mtDNA during starvation. | Paper_evidence | WBPaper00055078 | ||||||
Curator_confirmed | WBPerson14703 | ||||||||
EQ_annotations | GO_term | GO:0042594 | PATO:0000460 | Paper_evidence | WBPaper00055078 | ||||
Curator_confirmed | WBPerson14703 | ||||||||
GO:0005739 | PATO:0000460 | Paper_evidence | WBPaper00055078 | ||||||
Curator_confirmed | WBPerson14703 | ||||||||
Phenotype_not_observed (8) | |||||||||
Reference (25) | |||||||||
Remark | e369 is a coupled mutation. In addition to the curated lesion there is a CAG to TAG substitution with flanking sequences agccgacgattcatgagaatgagccgttgg taatgcaaagtatcagcagacggatgttaa | Paper_evidence | WBPaper00002050 | ||||||
Method | Substitution_allele |