WormBase Tree Display for Variation: WBVar00146344
expand all nodes | collapse all nodes | view schema
WBVar00146344 | Evidence | Paper_evidence | WBPaper00003653 | ||||||
---|---|---|---|---|---|---|---|---|---|
WBPaper00042557 | |||||||||
Name | Public_name | gm122 | |||||||
Other_name | C01G6.8b.1:c.757C>T | ||||||||
C01G6.8a.1:c.835C>T | |||||||||
CE39126:p.Gln120Ter | |||||||||
C01G6.8c.1:c.358C>T | |||||||||
C01G6.8c.2:c.358C>T | |||||||||
CE24774:p.Gln253Ter | |||||||||
CE32563:p.Gln279Ter | |||||||||
HGVSg | CHROMOSOME_II:g.9298616G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | C01G6 | |||||
Flanking_sequences | tataaagtttgcgaatcggattctaacaat | aaattgtttcgatttgcaagcacgattgtg | |||||||
Mapping_target | C01G6 | ||||||||
Type_of_mutation | Substitution | c | t | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (5) | |||||||||
Laboratory | NG | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000289 | |||||||
Transcript | C01G6.8c.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | C01G6.8c.1:c.358C>T | ||||||||
HGVSp | CE39126:p.Gln120Ter | ||||||||
cDNA_position | 461 | ||||||||
CDS_position | 358 | ||||||||
Protein_position | 120 | ||||||||
Exon_number | 3/8 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
C01G6.8b.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C01G6.8b.1:c.757C>T | ||||||||
HGVSp | CE24774:p.Gln253Ter | ||||||||
cDNA_position | 789 | ||||||||
CDS_position | 757 | ||||||||
Protein_position | 253 | ||||||||
Exon_number | 5/10 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
C01G6.8c.2 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C01G6.8c.2:c.358C>T | ||||||||
HGVSp | CE39126:p.Gln120Ter | ||||||||
cDNA_position | 363 | ||||||||
CDS_position | 358 | ||||||||
Protein_position | 120 | ||||||||
Exon_number | 2/7 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
C01G6.8a.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C01G6.8a.1:c.835C>T | ||||||||
HGVSp | CE32563:p.Gln279Ter | ||||||||
cDNA_position | 838 | ||||||||
CDS_position | 835 | ||||||||
Protein_position | 279 | ||||||||
Exon_number | 6/11 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
Interactor (53) | |||||||||
Genetics | Interpolated_map_position | II | 1.10234 | ||||||
Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00002978 | |||||
Curator_confirmed | WBPerson557 | ||||||||
Penetrance | Incomplete | 35 percent | Paper_evidence | WBPaper00002978 | |||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0000155 | Paper_evidence | WBPaper00006269 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 2 | Paper_evidence | WBPaper00006269 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Rescued_by_transgene | WBTransgene00006466 | ||||||||
WBTransgene00007261 | |||||||||
EQ_annotations | Anatomy_term | WBbt:0004905 | PATO:0000460 | Paper_evidence | WBPaper00006269 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004904 | PATO:0000460 | Paper_evidence | WBPaper00006269 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004902 | PATO:0000460 | Paper_evidence | WBPaper00006269 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004900 | PATO:0000460 | Paper_evidence | WBPaper00006269 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00006269 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000163 | Paper_evidence | WBPaper00002978 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Penetrance | Incomplete | 38 percent | Paper_evidence | WBPaper00002978 | |||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0000230 | Paper_evidence | WBPaper00031110 | |||||||
WBPaper00002978 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson557 | |||||||||
Penetrance | Low | 20 percent | Paper_evidence | WBPaper00002978 | |||||
Curator_confirmed | WBPerson557 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00031110 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000232 | Paper_evidence | WBPaper00006269 | |||||||
WBPaper00024898 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "In cam-1 mutants, CAN neurons usually fail to migrate to their proper positions; they are misplaced anteriorly either near their starting points or along their migratory routes. This migration defect is rescued by expression of pCAM-1 in cam-1(gm122) mutants (Forrester et al., 1999; Fig. 2B, Table 1)." (Figure 3) | Paper_evidence | WBPaper00006269 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Table 1 | Paper_evidence | WBPaper00024898 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | 84 | Paper_evidence | WBPaper00006269 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
86 | Paper_evidence | WBPaper00024898 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Rescued_by_transgene | WBTransgene00006465 | ||||||||
WBTransgene00007258 | |||||||||
EQ_annotations | Anatomy_term | WBbt:0006827 | PATO:0000460 | Paper_evidence | WBPaper00006269 | ||||
WBPaper00024898 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00006269 | |||||
WBPaper00024898 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00024898 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | "CAN was scored as defective if its nucleus was anterior to the V3 nucleus." | Paper_evidence | WBPaper00006269 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
From Table 1 legend: "A CAN was scored as defective if its nucleus was anterior to the V3 nucleus." | Paper_evidence | WBPaper00024898 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000308 | Paper_evidence | WBPaper00003653 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Dauer development is disrupted. | Paper_evidence | WBPaper00003653 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000384 | Paper_evidence | WBPaper00035405 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | SIA and SIB neurons had guidance errors at multiple positions | Paper_evidence | WBPaper00035405 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000469 | Paper_evidence | WBPaper00006269 | |||||||
WBPaper00024898 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "In cam-1(gm122) mutants, the QR descendants are sometimes misplaced posteriorly (Fig. 4C, Table 1; Forrester and Garriga, 1997). We found that expression of wild-type CAM-1 or any of the CAM-1 derivatives that retained the CRD was not sufficient to fully rescue the migrations of the QR descendants although pCAM-1 Δ CRD did rescue (Fig. 4C, Table 1)." | Paper_evidence | WBPaper00006269 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Table 1 | Paper_evidence | WBPaper00024898 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | 39 | Paper_evidence | WBPaper00006269 | |||||
WBPaper00024898 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
Rescued_by_transgene | WBTransgene00006466 | ||||||||
WBTransgene00007261 | |||||||||
EQ_annotations | Anatomy_term | WBbt:0004991 | PATO:0000460 | Paper_evidence | WBPaper00006269 | ||||
WBPaper00024898 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0003832 | PATO:0000460 | Paper_evidence | WBPaper00006269 | ||||||
WBPaper00024898 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004054 | PATO:0000460 | Paper_evidence | WBPaper00006269 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00006269 | |||||
WBPaper00024898 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00024898 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | "Because they occupy positions near each other, the data for SDQR and AVM were combined and are presented in QR column. SDQR and AVM were scored as defective if their nuclei were posterior to the V2.a nucleus." | Paper_evidence | WBPaper00006269 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
From Table 1 legend: "Because they occupy positions near each other, the data for SDQR and AVM were combined and are presented in the QR column. SDQR and AVM were scored as defective if their nuclei were posterior to the V2.a nucleus. The position of AQR, a third QR descendant, was not included because it migrates to a location near other nuclei with similar morphology." | Paper_evidence | WBPaper00024898 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000470 | Paper_evidence | WBPaper00006269 | |||||||
WBPaper00024898 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "In cam-1(gm122) mutants, the HSNs migrate anteriorly past their normal positions. Expression of pCAM-1 rescues this overmigration phenotype. In fact, pCAM-1 causes the final positions of HSNs to be shifted on average posterior to normal, presumably because of overexpression from the transgene (Forrester et al., 1999; Fig. 2C, Table 1)." (Figure 3) | Paper_evidence | WBPaper00006269 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
In cam-1(gm122) mutants, the HSN cell migrates anteriorly beyond its wild type destination (Figure 2, Table 1) | Paper_evidence | WBPaper00024898 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | 63 | Paper_evidence | WBPaper00006269 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
65 | Paper_evidence | WBPaper00024898 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Rescued_by_transgene | WBTransgene00006465 | ||||||||
WBTransgene00007258 | |||||||||
EQ_annotations | Anatomy_term | WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00006269 | ||||
WBPaper00024898 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00006269 | |||||
WBPaper00024898 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00024898 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | "Because HSN sometimes was misplaced anteriorly and other times was misplaced posteriorly, we present the data for both phenotypes. HSN was scored as misplaced anteriorly if its nucleus was anterior to the P5/6 nucleus and misplaced posteriorly if its nucleus was posterior to the V4 nucleus." | Paper_evidence | WBPaper00006269 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
From Table 1 legend: "Because the HSNs were sometimes misplaced anteriorly and at other times were misplaced posteriorly, we present the data for both phenotypes. An HSN was scored as misplaced anteriorly if its nucleus was anterior to the P5/6 nucleus and as misplaced posteriorly if its nucleus was posterior to the V4 nucleus." | Paper_evidence | WBPaper00024898 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000471 | Paper_evidence | WBPaper00006269 | |||||||
WBPaper00024898 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 1 | Paper_evidence | WBPaper00006269 | ||||||
WBPaper00024898 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | 27 | Paper_evidence | WBPaper00006269 | |||||
WBPaper00024898 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
Rescued_by_transgene | WBTransgene00006465 | ||||||||
WBTransgene00007258 | |||||||||
EQ_annotations | Anatomy_term | WBbt:0005406 | PATO:0000460 | Paper_evidence | WBPaper00006269 | ||||
WBPaper00024898 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00006269 | |||||
WBPaper00024898 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00024898 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | "ALM was scored as defective if its nucleus was anterior to the V2 nucleus." | Paper_evidence | WBPaper00006269 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
From the Table 1 legend: "An ALM was scored as defective if its nucleus was anterior to the V2 nucleus." | Paper_evidence | WBPaper00024898 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000594 | Paper_evidence | WBPaper00003653 | |||||||
WBPaper00006269 | |||||||||
WBPaper00024898 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2987 | |||||||||
Remark | This mutation exhibits stronger effects on cell migrations than does gm105. This phenotype is rescued by a kinase-activity defective CAM-1::GFP transgene as well as a functional cam-1::GFP transgene. | Paper_evidence | WBPaper00003653 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Table 1 | Paper_evidence | WBPaper00006269 | |||||||
WBPaper00024898 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | 14 | Paper_evidence | WBPaper00006269 | |||||
WBPaper00024898 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
Rescued_by_transgene | WBTransgene00006465 | ||||||||
WBTransgene00007258 | |||||||||
EQ_annotations | Anatomy_term | WBbt:0006826 | PATO:0000460 | Paper_evidence | WBPaper00006269 | ||||
WBPaper00024898 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00006269 | |||||
WBPaper00024898 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00024898 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | "Because BDU sometimes was misplaced anteriorly and other times was misplaced posteriorly, we present the data for both phenotypes. BDU was scored as misplaced anteriorly if its nucleus was anterior to its normal position immediately anterior to V1 and misplaced posteriorly if its nucleus was posterior to the V1 nucleus." | Paper_evidence | WBPaper00006269 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
From Table 1 legend: "Because BDUs sometimes were misplaced anteriorly and at other times were misplaced posteriorly, we present the data for both phenotypes. A BDU was scored as misplaced anteriorly if its nucleus was anterior to its normal position immediately anterior to V1 and misplaced posteriorly if its nucleus was posterior to the V1 nucleus." | Paper_evidence | WBPaper00024898 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00003653 | |||||||
WBPaper00002978 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson557 | |||||||||
Remark | Locomotion is disrupted. | Paper_evidence | WBPaper00003653 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Complete | 100 percent | Paper_evidence | WBPaper00002978 | |||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0000883 | Paper_evidence | WBPaper00035405 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | cam-1 mutants had substantial anterior nerve ring defects | Paper_evidence | WBPaper00035405 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001224 | Paper_evidence | WBPaper00003653 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Instead of extending its axon posteriorly, the most anterior CP neuron in 26-55% of cam-1 mutants extended its axon anteriorly to the head, in addition, the polarity of the P3.aap precursor division may have been reversed | Paper_evidence | WBPaper00003653 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001398 | Paper_evidence | WBPaper00037046 | |||||||
Curator_confirmed | WBPerson274 | ||||||||
WBPhenotype:0001585 | Paper_evidence | WBPaper00003653 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 12% of V1 cell divisions are reversed, with the anterior daughter adopting the blast-cell fate and the posterior daughter joining the syncytium. This phenotype was not rescued with a kinase-minus CAM-1::GFP transgene, but was rescued by a functional-cam-1::GFP. Other migration defects were observed for V2, V4, CAN as well as with BDU and HSN, which migrated beyond their normal destination. | Paper_evidence | WBPaper00003653 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000218 | Paper_evidence | WBPaper00031110 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No significant number of overinduced animals (worms with greater than three VPCs induced) were detected. | Paper_evidence | WBPaper00031110 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00031110 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000219 | Paper_evidence | WBPaper00031110 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No underinduced animals (worms with fewer than 22 vulval cells or fewer than three VPCs induced) were detected. | Paper_evidence | WBPaper00031110 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00031110 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000306 | Paper_evidence | WBPaper00024898 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Wild-type animals or cam-1 mutants that carry mab-5::gfp expressed high levels of GFP in QL descendants but not in QR descendants (Figure 5; Table 2)." | Paper_evidence | WBPaper00024898 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004993 | PATO:0000460 | Paper_evidence | WBPaper00024898 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004086 | PATO:0000460 | Paper_evidence | WBPaper00024898 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | muIs16 [mab-5::GFP] | Paper_evidence | WBPaper00024898 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000406 | Paper_evidence | WBPaper00002978 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0000469 | Paper_evidence | WBPaper00006269 | |||||||
WBPaper00024898 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "In cam-1(gm122) mutants, the QL descendants usually migrate to their proper positions (Fig. 4B)... To further investigate the role in Q cell migration of CAM-1 domains, we assessed the position of Q cell descendants in cam-1(sa692) and cam-1(ks52) (Fig. 5, Table 1). The final positions of QL descendants were similar in all three cam-1 mutants to wild type, suggesting that CAM-1 is not required for proper QL migration." | Paper_evidence | WBPaper00006269 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Table 1, Figure 6 | Paper_evidence | WBPaper00024898 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004993 | PATO:0000460 | Paper_evidence | WBPaper00006269 | ||||
WBPaper00024898 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004086 | PATO:0000460 | Paper_evidence | WBPaper00006269 | ||||||
WBPaper00024898 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004056 | PATO:0000460 | Paper_evidence | WBPaper00006269 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00006269 | |||||
WBPaper00024898 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00024898 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | "The percentage of QL cell descendants that were not located posterior to V4.p is presented. These represent QL descendants that have migrated anteriorly, rather than posteriorly. Because they occupy positions near each other, the data for SDQL and PVM were combined." | Paper_evidence | WBPaper00006269 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
From Table 1 legend: "Because QL descendants sometimes were misplaced anteriorly and at other times were misplaced posteriorly, we present the data for both phenotypes. A QL cell descendant was scored as misplaced anteriorly if its nucleus was anterior to V4.p and misplaced posteriorly if its nucleus was posterior to V5.p. Because they occupy positions near each other, the data for SDQL and PVM were combined." | Paper_evidence | WBPaper00024898 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000700 | Paper_evidence | WBPaper00002978 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0001652 | Paper_evidence | WBPaper00032446 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0002193 | Paper_evidence | WBPaper00057191 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 0% n=54 | Paper_evidence | WBPaper00057191 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Image | WBPicture0000014918 | Paper_evidence | WBPaper00057191 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (11) | |||||||||
Method | Substitution_allele |