WormBase Tree Display for Variation: WBVar00249816
expand all nodes | collapse all nodes | view schema
WBVar00249816 | Name | Public_name | tm788 | |||||
---|---|---|---|---|---|---|---|---|
HGVSg | CHROMOSOME_X:g.12466567_12467370delinsAAAGCAATATAAATTTTAAAAGCAATACCTCTCCGATTGCTATCATGTGAATCTGTTGAGTCAGCTTC | |||||||
Sequence_details | SMap | S_parent | Sequence | T18D3 | ||||
Flanking_sequences | atcatgtgaatctgttgagtcagcttcatc | taaattcatatgcatatggctcactctgac | ||||||
Mapping_target | T18D3 | |||||||
Source_location | 7 | CHROMOSOME_X | 12466566 | 12467371 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Insertion | AAAGCAATATAAATTTTAAAAGCAATACCTCTCCGATTGCTATCATGTGAATCTGTTGAGTCAGCTTC | ||||||
Deletion | ||||||||
PCR_product | tm788_external | |||||||
tm788_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 788 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00011821 | ||||||
Transcript | T18D3.3a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
cDNA_position | ?-245 | |||||||
CDS_position | ?-105 | |||||||
Protein_position | ?-35 | |||||||
Intron_number | 2/9 | |||||||
Exon_number | 1-3/10 | |||||||
Interactor | WBInteraction000524618 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | X | ||||||
Description | Phenotype | WBPhenotype:0000136 | Paper_evidence | WBPaper00040622 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | An analysis of ttm-1 transcripts using qRT-PCR showed a small increase in ttm-1 transcript levels in cdf-2 mutant animals compared to wild-type animals (data not shown). | Paper_evidence | WBPaper00040622 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000137 | Paper_evidence | WBPaper00033166 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | The abundance of the cdf-2 transcript was dramatically reduced by approximately 1,000-fold in the cdf-2(tm788) mutant compared to wild type | Paper_evidence | WBPaper00033166 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00033166 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Quantitative, real-time PCR analysis | Paper_evidence | WBPaper00033166 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001747 | Paper_evidence | WBPaper00033166 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | cdf-2(tm788) mutant animals displayed reduced population growth compared to wild-type animals in 30 M to 480 M dietary zinc | Paper_evidence | WBPaper00033166 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00033166 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00003477 | Paper_evidence | WBPaper00033166 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Eggs were transferred to CeMM with 18-19 different concentrations of zinc, ranging from no added zinc to 2 mM zinc | Paper_evidence | WBPaper00033166 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001749 | Paper_evidence | WBPaper00040622 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | cdf-2(tm788) mutant animals displayed significantly lower growth rates than wild-type animals at all concentrations of supplemental zinc (Figure 6B). | Paper_evidence | WBPaper00040622 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Affected_by | Molecule | WBMol:00005064 | Paper_evidence | WBPaper00040622 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Treatment | Hermaphrodites were synchronized at the L1 stage and cultured on noble agar minimal medium (NAMM) dishes for 3 days with supplemental zinc. The length of individual animals was measured using microscopy and ImageJ software. | Paper_evidence | WBPaper00040622 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001849 | Paper_evidence | WBPaper00033166 | ||||||
WBPaper00040622 | ||||||||
Curator_confirmed | WBPerson712 | |||||||
WBPerson2987 | ||||||||
Remark (3) | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00033166 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00005064 | Paper_evidence | WBPaper00033166 | ||||
WBPaper00040622 | ||||||||
Curator_confirmed | WBPerson712 | |||||||
WBPerson2987 | ||||||||
Phenotype_assay | Treatment | Determination of zinc content of C. elegans using inductively coupled plasma-mass spectrometry (ICP-MS) | Paper_evidence | WBPaper00033166 | ||||
Curator_confirmed | WBPerson712 | |||||||
cdf-2(tm788) L1 stage hermaphrodites were precultured for 12 hours on noble agar minimal medium (NAMM) dishes containing 0 or 50 micromolar supplemental zinc, cultured for 3 days on NGM dishes with 100 micromolar TPEN (zinc chelator,N,N,N0,N0-tetrakis (2-pyridylmethyl) ethylenediamine), and analyzed individually for length. | Paper_evidence | WBPaper00040622 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002245 | Paper_evidence | WBPaper00040622 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | cdf-2(tm788) mutant animals displayed significantly lower FluoZin-3 fluorescence at both 0 mM and 100 mM supplemental zinc compared to wild-type animals (Figures 3C and 3D), indicative of reduced endogenous zinc levels. cdf-2(tm788) mutants also exhibited reduced zinc content as determined by inductively coupled plasma-mass spectrometry (ICP-MS) (Figure 2B). | Paper_evidence | WBPaper00040622 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_not_observed | WBPhenotype:0000062 | Paper_evidence | WBPaper00033166 | |||||
Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | |||||||
Remark (2) | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00033166 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000103 | Paper_evidence | WBPaper00040622 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | cdf-2(tm788) mutant animals displayed bilobed gut granules that contained PGP-2::GFP on both lobes and LysoTracker asymmetrically on one lobe (Figure S7A), similar to wild-type. These results indicate that CDF-2 activity is not necessary for the formation of bilobed gut granules. | Paper_evidence | WBPaper00040622 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | PGP-2::GFP | Paper_evidence | WBPaper00040622 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000520 | Paper_evidence | WBPaper00033166 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | cdf-2(tm788) mutant animals appeared to have normal morphology | Paper_evidence | WBPaper00033166 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00033166 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000592 | Paper_evidence | WBPaper00040622 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | cdf-2(tm788) mutant animals were similar to wildtype animals in sensitivity to dietary copper (data not shown). | Paper_evidence | WBPaper00040622 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Affected_by | Molecule | WBMol:00002862 | Paper_evidence | WBPaper00040622 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00033166 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | cdf-2(tm788) mutant animals appeared to have normal body movement | Paper_evidence | WBPaper00033166 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00033166 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00033166 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | cdf-2(tm788) hermaphrodites and males were fertile | Paper_evidence | WBPaper00033166 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00033166 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001653 | Paper_evidence | WBPaper00040622 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | cdf-2(tm788) mutant animals were similar to wildtype animals in sensitivity to dietary cadmium (Figure 6D). | Paper_evidence | WBPaper00040622 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Affected_by | Molecule | WBMol:00003022 | Paper_evidence | WBPaper00040622 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Treatment | Hermaphrodites were synchronized at the L1 stage and cultured on noble agar minimal medium (NAMM) dishes for 3 days with supplemental cadmium. The length of individual animals was measured using microscopy and ImageJ software. | Paper_evidence | WBPaper00040622 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001862 | Paper_evidence | WBPaper00040622 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | cdf-2(tm788) mutants show no changes in overall manganese content, as determined by inductively coupled plasma-mass spectrometry (ICP-MS), compared to wild type controls (Figure S3C). | Paper_evidence | WBPaper00040622 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002030 | Paper_evidence | WBPaper00040622 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | cdf-2(tm788) mutants show no changes in overall magnesium content, as determined by inductively coupled plasma-mass spectrometry (ICP-MS), compared to wild type controls (Figure S3A). | Paper_evidence | WBPaper00040622 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002046 | Paper_evidence | WBPaper00040622 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | cdf-2(tm788) mutants show no changes in overall iron content, as determined by inductively coupled plasma-mass spectrometry (ICP-MS), compared to wild type controls (Figure S3B). | Paper_evidence | WBPaper00040622 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002247 | Paper_evidence | WBPaper00040622 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | cdf-2(tm788) mutants show no changes in overall copper content, as determined by inductively coupled plasma-mass spectrometry (ICP-MS), compared to wild type controls (Figure S3D). | Paper_evidence | WBPaper00040622 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Reference | WBPaper00040622 | |||||||
WBPaper00033166 | ||||||||
Remark (2) | ||||||||
Method | NBP_knockout_allele |