WormBase Tree Display for Variation: WBVar00142933
expand all nodes | collapse all nodes | view schema
WBVar00142933 | Evidence | Paper_evidence | WBPaper00002646 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e49 | |||||||
Other_name | n49 | Paper_evidence | WBPaper00043983 | ||||||
CE04840:p.Ala546Thr | |||||||||
CE48967:p.Ala585Thr | |||||||||
CE49123:p.Ala587Thr | |||||||||
R13A1.4c.1:c.1759G>A | |||||||||
R13A1.4a.1:c.1756G>A | |||||||||
CE26381:p.Ala586Thr | |||||||||
R13A1.4b.1:c.1753G>A | |||||||||
R13A1.4d.1:c.1636G>A | |||||||||
HGVSg | CHROMOSOME_IV:g.7202315G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | R13A1 | |||||
Flanking_sequences | ctaccatctgaagagcatagacattgtaat | cgaagtcaaaaattgatcgttagttttttt | |||||||
Mapping_target | R13A1 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00002646 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin (4) | |||||||||
Affects | Gene | WBGene00006748 | |||||||
Transcript | R13A1.4d.1 (12) | ||||||||
R13A1.4c.1 (12) | |||||||||
R13A1.4a.1 (12) | |||||||||
R13A1.4b.1 (12) | |||||||||
Genetics | Interpolated_map_position | IV | 3.29389 | ||||||
Mapping_data (3) | |||||||||
Description | Phenotype | WBPhenotype:0000002 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | kinks both forward and backward | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00000031 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson712 | |||||||||
Remark | Moves well but slowly and irregularly, e49/+ very slightly uncoordinated. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES2_Difficult_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001331 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | swollen ventral cord motor neurons | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005829 | PATO:0000460 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00010943 | ||||||||
WBPaper00015271 | |||||||||
WBPaper00015305 | |||||||||
WBPaper00015371 | |||||||||
WBPaper00022049 | |||||||||
WBPaper00000031 | |||||||||
WBPaper00015036 | |||||||||
WBPaper00015162 | |||||||||
WBPaper00016317 | |||||||||
WBPaper00016181 | |||||||||
WBPaper00011159 | |||||||||
WBPaper00022760 | |||||||||
Remark | n49 is a typo of e49 | Paper_evidence | WBPaper00043983 | ||||||
Method | Substitution_allele |