WormBase Tree Display for Variation: WBVar00000013
expand all nodes | collapse all nodes | view schema
| WBVar00000013 | Evidence | Person_evidence | WBPerson5734 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | ad464 | |||||||
| Other_name | F13G3.8.1:c.3G>A | ||||||||
| CE05620:p.Met1? | |||||||||
| HGVSg | CHROMOSOME_I:g.7311732C>T | ||||||||
| Sequence_details | SMap | S_parent | Sequence | F13G3 | |||||
| Flanking_sequences | aaagggcactaaatcaattggaggcagcat | aatatgctcgggagcatgttctcgatggtc | |||||||
| Mapping_target | F13G3 | ||||||||
| Type_of_mutation | Substitution | g | a | Person_evidence | WBPerson5734 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00005462 | ||||||||
| Laboratory | DA | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00001136 | |||||||
| Transcript | F13G3.8.1 (12) | ||||||||
| Genetics | Interpolated_map_position | I | 1.90002 | ||||||
| Mapping_data | In_2_point | 6194 | |||||||
| 6195 | |||||||||
| In_multi_point (14) | |||||||||
| In_pos_neg_data | 8294 | ||||||||
| 8295 | |||||||||
| Description | Phenotype | WBPhenotype:0000020 | Paper_evidence | WBPaper00002505 | |||||
| Curator_confirmed | WBPerson621 | ||||||||
| WBPhenotype:0000329 | Paper_evidence | WBPaper00001709 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | Corpus and terminal bulb contractions are unsynchronized | Paper_evidence | WBPaper00001709 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Penetrance | Complete | Paper_evidence | WBPaper00001709 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0003732 | PATO:0000460 | Paper_evidence | WBPaper00001709 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBbt:0003733 | PATO:0000460 | Paper_evidence | WBPaper00001709 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00001709 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0000547 | Paper_evidence | WBPaper00001709 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | eat-5 adults with unsynchronized pumping appear starved | Paper_evidence | WBPaper00001709 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00001709 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0000685 | Paper_evidence | WBPaper00001709 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Reference | WBPaper00001709 | ||||||||
| WBPaper00014509 | |||||||||
| WBPaper00015805 | |||||||||
| WBPaper00002505 | |||||||||
| Method | Substitution_allele |
