WormBase Tree Display for Variation: WBVar00000325
expand all nodes | collapse all nodes | view schema
WBVar00000325 | Evidence | Paper_evidence | WBPaper00028766 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | ay9 | ||||||
Other_name | F31E3.1.1:c.234G>A | |||||||
CE01241:p.Met78Ile | ||||||||
HGVSg | CHROMOSOME_III:g.6980311G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | F31E3 | ||||
Flanking_sequences | agatcctcaattaatgcgacttgataatat | ttagtggcggaaggcgttgcaggaccagat | ||||||
Mapping_target | F31E3 | |||||||
Type_of_mutation | Substitution | g | h | Paper_evidence | WBPaper00028766 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00028765 | |||||||
Laboratory | NH | |||||||
Status | Live | |||||||
Affects (3) | ||||||||
Genetics | Interpolated_map_position | III | -0.853262 | |||||
Mapping_data | In_multi_point (2) | |||||||
Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00028766 | ||||
Curator_confirmed | WBPerson557 | |||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00028766 | |||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0000165 | Paper_evidence | WBPaper00028766 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | Expression of ajm-1p::gfp in a ceh-20(ay9) In L1 larva only P5.p and P6.p remained unfused, the other VPCs fused with the hypodermis. In wildtype all VPC remained unfused. | Paper_evidence | WBPaper00028766 | |||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_assay | Genotype | ajm-1::gfp | Paper_evidence | WBPaper00028766 | ||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0000220 | Paper_evidence | WBPaper00028766 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | Failure to execute secondary vulval cell fate. In the ceh-20(ay9) animal, both the anterior and posterior secondary vulval cells are missing: P5.p and P7.p remained non-induced, adopting tertiary fates. | Paper_evidence | WBPaper00028766 | |||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0000245 | Paper_evidence | WBPaper00028766 | ||||||
Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | |||||||
WBPerson557 | ||||||||
Remark | Egl, SM migration defects. Stronger alleles are larval lethal, Unc,defective in Q daughter migrations, M lineage. Males do not mate, have defective tails | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00028766 | |||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0000624 | Paper_evidence | WBPaper00028766 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | The lack of utse (uterine seam) syncytium formation was evident in 73 percent of ceh-20(ay9) animals. | Paper_evidence | WBPaper00028766 | |||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0000640 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Egl, SM migration defects. Stronger alleles are larval lethal, Unc,defective in Q daughter migrations, M lineage. Males do not mate, have defective tails | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000698 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Vul, Egl, SM migration defects. Stronger alleles are larval lethal, Unc,defective in Q daughter migrations, M lineage. Males do not mate, have defective tails | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001278 | Paper_evidence | WBPaper00028766 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | ceh-20(ay9) mutations significantly diminished the expression of lag-2::gfp in the VPCs prior to vulval induction. In wildtype worms, lag-2::gfp was continuously expressed in all VPCs prior to vulval induction, but its expression became restricted to P6.p at the time of vulval induction. | Paper_evidence | WBPaper00028766 | |||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_assay | Genotype | lag-2::gfp | Paper_evidence | WBPaper00028766 | ||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0001414 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Males do not mate, have defective tails | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001586 | Paper_evidence | WBPaper00028766 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | We found that 14 percent of ceh-20 (ay9) larvae have two gonadal cells that expressed the AC marker LIN-3::GFP reporter versus the normal single cell found in wild-type animals. Dual AC phenotype. | Paper_evidence | WBPaper00028766 | |||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_assay | Genotype | lin-3::gfp | Paper_evidence | WBPaper00028766 | ||||
Curator_confirmed | WBPerson557 | |||||||
Reference | WBPaper00028766 | |||||||
Method | Substitution_allele |