WormBase Tree Display for Variation: WBVar00000490
expand all nodes | collapse all nodes | view schema
WBVar00000490 | Evidence | Paper_evidence | WBPaper00005019 | ||
---|---|---|---|---|---|
Name | Public_name | bn88 | |||
Other_name | F54C1.3a.1:c.1978A>T | ||||
F54C1.3b.1:c.1921A>T | |||||
F54C1.3a.2:c.1978A>T | |||||
CE53747:p.Thr641Ser | |||||
CE11046:p.Thr660Ser | |||||
HGVSg | CHROMOSOME_I:g.5001786A>T | ||||
Sequence_details | SMap | S_parent | Sequence | F54C1 | |
Flanking_sequences | ttttcagaaatattcttcccaagtggaaaa | ctgaactattcaatattctatgcagacagt | |||
Mapping_target | F54C1 | ||||
Type_of_mutation | Substitution | a | t | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin (3) | |||||
Affects | Gene | WBGene00003221 | |||
Transcript | F54C1.3a.1 (12) | ||||
F54C1.3b.1 (12) | |||||
F54C1.3a.2 (12) | |||||
Interactor | WBInteraction000557641 | ||||
Genetics | Interpolated_map_position | I | -0.428729 | ||
Mapping_data | In_multi_point | 2095 | |||
Reference | WBPaper00005019 | ||||
Remark | This substitution is coupled with a downstream deletion of a4945 causing a frameshift at T660 | Paper_evidence | WBPaper00005019 | ||
Method | Substitution_allele |