WormBase Tree Display for Variation: WBVar00087930
expand all nodes | collapse all nodes | view schema
WBVar00087930 | Name | Public_name | hs9 | |||||
---|---|---|---|---|---|---|---|---|
Other_name (21) | ||||||||
HGVSg | CHROMOSOME_X:g.15124663G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | R07D5 | ||||
Flanking_sequences | atcgacaaattggctattaccaatgggtgc | gtttattcttgctattgaggccttgttgtt | ||||||
Mapping_target | R07D5 | |||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00025986 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00008419 | |||||||
Laboratory | HH | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00006747 | ||||||
Transcript (11) | ||||||||
Genetics | Interpolated_map_position | X | 22.0113 | |||||
Description | Phenotype | WBPhenotype:0000002 | Paper_evidence | WBPaper00033075 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | hs9 is a temperature-sensitive allele of unc-7 that displays severe kinker locomotion defects at 15C | Paper_evidence | WBPaper00033075 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Temperature_sensitive | Cold_sensitive | Paper_evidence | WBPaper00033075 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00033138 | ||||||
Curator_confirmed | WBPerson621 | |||||||
WBPhenotype:0000847 | Paper_evidence | WBPaper00033075 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | When cultured at 15C throughout development , 95% of the animals displayed a reduction of bright hpIs3 ( GFP: : SYD-2 ) puncta , compared with 5% animals maintained at 22C | Paper_evidence | WBPaper00033075 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Temperature_sensitive | Cold_sensitive | Paper_evidence | WBPaper00033075 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Reference | WBPaper00033075 | |||||||
WBPaper00033138 | ||||||||
WBPaper00025986 | ||||||||
Method | Substitution_allele |