WormBase Tree Display for Variation: WBVar00088122
expand all nodes | collapse all nodes | view schema
WBVar00088122 | Evidence | Paper_evidence | WBPaper00031651 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | js317 | |||||||
Other_name | CE06730:p.Trp861Ter | ||||||||
C01B7.6.1:c.2582delinsA | |||||||||
HGVSg | CHROMOSOME_V:g.8816530delinsT | ||||||||
Sequence_details | SMap | S_parent | Sequence | C01B7 | |||||
Flanking_sequences | tagcacgaccagctggcgagaaagctggat | aatgcgatccctgaaaaagtttctggttt | |||||||
Mapping_target | C01B7 | ||||||||
Type_of_mutation | Substitution | gg | rr | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00029056 | ||||||||
Laboratory | NM | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00004457 | |||||||
Transcript | C01B7.6.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | C01B7.6.1:c.2582delinsA | ||||||||
HGVSp | CE06730:p.Trp861Ter | ||||||||
cDNA_position | 2582-2583 | ||||||||
CDS_position | 2582-2583 | ||||||||
Protein_position | 861 | ||||||||
Exon_number | 6/16 | ||||||||
Codon_change | tGG/tAG | ||||||||
Amino_acid_change | W/* | ||||||||
Genetics | Interpolated_map_position | V | 1.62282 | ||||||
Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00004147 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutants have a subtle phenotype of retaining eggs. | Paper_evidence | WBPaper00004147 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00004147 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | jsIs37[SNB-1::GFP] | Paper_evidence | WBPaper00004147 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000583 | Paper_evidence | WBPaper00004147 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutants are mildly dumpy. | Paper_evidence | WBPaper00004147 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00004147 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | jsIs37[SNB-1::GFP] | Paper_evidence | WBPaper00004147 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000625 | Paper_evidence | WBPaper00004147 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Synapses either do not form or lack the normal complement of synaptic vesicles. | Paper_evidence | WBPaper00004147 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00004147 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0008431 | PATO:0000460 | Paper_evidence | WBPaper00004147 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | jsIs37[SNB-1::GFP] | Paper_evidence | WBPaper00004147 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000633 | Paper_evidence | WBPaper00045955 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | Branch defects scored in PLM neuron. | Paper_evidence | WBPaper00045955 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00045955 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0000816 | Paper_evidence | WBPaper00004147 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | During development, most (59%, n=54) mutant animals extend a synaptic branch from at least one of the bilateral axons. Nevertheless, branches appear to retract later in development. Regardless, normal patterns of synaptic branch targeting is often observed. | Paper_evidence | WBPaper00004147 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00004147 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0008431 | PATO:0000460 | Paper_evidence | WBPaper00004147 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | jsIs37[SNB-1::GFP] | Paper_evidence | WBPaper00004147 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000847 | Paper_evidence | WBPaper00004147 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | rpm-1 animals exhibit altered stereotypical patterns of presynaptic jsIs37[SNB-1::GFP] fluorescence. Animals never display the two fluorescent patches in the VNC and are missing several puncta in the nerve ring neuropil. These phenotypes persist throughout development. | Paper_evidence | WBPaper00004147 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00004147 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | jsIs37[SNB-1::GFP] | Paper_evidence | WBPaper00004147 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001331 | Paper_evidence | WBPaper00004147 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Morphology of different classes of motor neurons is altered. | Paper_evidence | WBPaper00004147 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00004147 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | jsIs37[SNB-1::GFP] | Paper_evidence | WBPaper00004147 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000315 | Paper_evidence | WBPaper00004147 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutants respond to touch. | Paper_evidence | WBPaper00004147 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00004147 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | jsIs37[SNB-1::GFP] | Paper_evidence | WBPaper00004147 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000354 | Paper_evidence | WBPaper00004147 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | mec-7 and mec-18 promoter-specific expression are still observed in mechanosensory neurons. Neurons are labeled by MEC-7 antibody. Cell bodies are positioned normally. Cell processes are fully extended, albeit often to far. | Paper_evidence | WBPaper00004147 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00004147 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0008431 | PATO:0000460 | Paper_evidence | WBPaper00004147 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | jsIs37[SNB-1::GFP] | Paper_evidence | WBPaper00004147 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00004147 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | rpm-1 mutants move well. | Paper_evidence | WBPaper00004147 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00004147 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | jsIs37[SNB-1::GFP] | Paper_evidence | WBPaper00004147 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001685 | Paper_evidence | WBPaper00004147 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Expression of GFP throughout AVA and AVD, as well as several other cell types, using the glr-1 promoter indicates normal morphology of the postsynaptic neurons (data not shown). | Paper_evidence | WBPaper00004147 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00004147 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | jsIs37[SNB-1::GFP] | Paper_evidence | WBPaper00004147 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00031651 | ||||||||
WBPaper00004147 | |||||||||
WBPaper00045955 | |||||||||
Remark | Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00004457 Amber_UAG_or_Opal_UGA W(861)Stop | ||||||||
Method | Substitution_allele |