WormBase Tree Display for Variation: WBVar00088148

WBVar00088148 Evidence: Paper_evidence: WBPaper00004146
  Name: Public_name: ju41
    Other_name: CE06730:p.Gln3563Ter
      C01B7.6.1:c.10687C>T
    HGVSg: CHROMOSOME_V:g.8806412G>A
  Sequence_details: SMap: S_parent: Sequence: C01B7
    Flanking_sequences: aatggtccaagaattgttttccgttttatg agtgtccattgtgcattcaacctattgaac
    Mapping_target: C01B7
    Type_of_mutation: Substitution: c t
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00005362
    Laboratory: CZ
    Status: Live
  Affects: Gene: WBGene00004457
    Transcript: C01B7.6.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: C01B7.6.1:c.10687C>T
        HGVSp: CE06730:p.Gln3563Ter
        cDNA_position: 10687
        CDS_position: 10687
        Protein_position: 3563
        Exon_number: 13/16
        Codon_change: Cag/Tag
        Amino_acid_change: Q/*
    Interactor: WBInteraction000556059
  Genetics: Interpolated_map_position: V 1.61803
  Description: Phenotype: WBPhenotype:0000436 Paper_evidence: WBPaper00004146
        Curator_confirmed: WBPerson712
        Remark: Some SNT-1 puncta were larger than those in unc-5(e53) animals. Paper_evidence: WBPaper00004146
            Curator_confirmed: WBPerson712
        Recessive: Paper_evidence: WBPaper00004146
          Curator_confirmed: WBPerson712
        Phenotype_assay: Genotype: unc-5(e53) Paper_evidence: WBPaper00004146
              Curator_confirmed: WBPerson712
      WBPhenotype:0000962 Paper_evidence: WBPaper00004146
        Curator_confirmed: WBPerson712
        Remark: The total number of the synaptic vesicle SNB-1::GFP puncta was reduced, and regions along the dorsal and ventral nerve cords often contained no GFP puncta. The mutant GFP puncta patterns in animals were similar to ju23 and did not show obvious differences from 15C to 25C. In these mutants, the abnormally shaped GFP puncta of the DD neurons were more severe than those of the VD neurons. The mutant phenotypes of homozygous animals were less severe than those of mutant/Df (data not shown), suggesting that this allele is not a null mutation. | UNC-49B::GFP fluorescent puncta were clustered in some regions, while absent in others along the nerve cords. Paper_evidence: WBPaper00004146
            Curator_confirmed: WBPerson712
        Recessive: Paper_evidence: WBPaper00004146
          Curator_confirmed: WBPerson712
        EQ_annotations: Anatomy_term: WBbt:0005270 PATO:0000460 Paper_evidence: WBPaper00004146
                Curator_confirmed: WBPerson712
            WBbt:0005303 PATO:0000460 Paper_evidence: WBPaper00004146
                Curator_confirmed: WBPerson712
        Phenotype_assay: Genotype: sem-4(n1376); juIs1 Paper_evidence: WBPaper00004146
              Curator_confirmed: WBPerson712
      WBPhenotype:0001321 Paper_evidence: WBPaper00028886
        Curator_confirmed: WBPerson48
        Remark: Based on visualization using a SNB-1::VENUS transgene. Paper_evidence: WBPaper00028886
            Curator_confirmed: WBPerson48
      WBPhenotype:0002479 Paper_evidence: WBPaper00053323
        Curator_confirmed: WBPerson9270
        Remark: Figure 7, length of regeneration increased after axotomy of the PLM neurons Paper_evidence: WBPaper00053323
            Curator_confirmed: WBPerson9270
        EQ_annotations: Anatomy_term: WBbt:0005490 PATO:0000460 Paper_evidence: WBPaper00053323
                Curator_confirmed: WBPerson9270
          GO_term: GO:0030424 PATO:0000460 Paper_evidence: WBPaper00053323
                Curator_confirmed: WBPerson9270
    Phenotype_not_observed: WBPhenotype:0000633 Paper_evidence: WBPaper00053323
        Curator_confirmed: WBPerson9270
        EQ_annotations: GO_term: GO:0030424 PATO:0000460 Paper_evidence: WBPaper00053323
                Curator_confirmed: WBPerson9270
      WBPhenotype:0000680 Paper_evidence: WBPaper00004146
        Curator_confirmed: WBPerson712
        Remark: Animals showed the same sensitivity to aldicarb as wild-type animals. Paper_evidence: WBPaper00004146
            Curator_confirmed: WBPerson712
      WBPhenotype:0002364 Paper_evidence: WBPaper00053323
        Curator_confirmed: WBPerson9270
        EQ_annotations: GO_term: GO:0030424 PATO:0000460 Paper_evidence: WBPaper00053323
                Curator_confirmed: WBPerson9270
  Reference: WBPaper00028886
    WBPaper00004146
    WBPaper00053323
  Method: Substitution_allele