WormBase Tree Display for Variation: WBVar00088151
expand all nodes | collapse all nodes | view schema
WBVar00088151 | Evidence | Paper_evidence | WBPaper00027711 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | ju49 | ||||||
Other_name (13) | ||||||||
HGVSg | CHROMOSOME_X:g.7224053C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | ZK867 | ||||
Flanking_sequences | attgtggccgctacaaatgcttccggacag | gaggcgatggaactccggattccacagaca | ||||||
Mapping_target | ZK867 | |||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00027711 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | CZ | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00044068 | ||||||
Transcript | ZK867.1d.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | ZK867.1d.1:c.1036C>T | |||||||
HGVSp | CE29653:p.Arg346Ter | |||||||
cDNA_position | 1036 | |||||||
CDS_position | 1036 | |||||||
Protein_position | 346 | |||||||
Exon_number | 7/9 | |||||||
Codon_change | Cga/Tga | |||||||
Amino_acid_change | R/* | |||||||
ZK867.1b.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK867.1b.1:c.85C>T | |||||||
HGVSp | CE28198:p.Arg29Ter | |||||||
cDNA_position | 1356 | |||||||
CDS_position | 85 | |||||||
Protein_position | 29 | |||||||
Exon_number | 7/10 | |||||||
Codon_change | Cga/Tga | |||||||
Amino_acid_change | R/* | |||||||
ZK867.1b.3 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK867.1b.3:c.85C>T | |||||||
HGVSp | CE28198:p.Arg29Ter | |||||||
cDNA_position | 1236 | |||||||
CDS_position | 85 | |||||||
Protein_position | 29 | |||||||
Exon_number | 7/10 | |||||||
Codon_change | Cga/Tga | |||||||
Amino_acid_change | R/* | |||||||
ZK867.1b.4 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK867.1b.4:c.85C>T | |||||||
HGVSp | CE28198:p.Arg29Ter | |||||||
cDNA_position | 904 | |||||||
CDS_position | 85 | |||||||
Protein_position | 29 | |||||||
Exon_number | 7/10 | |||||||
Codon_change | Cga/Tga | |||||||
Amino_acid_change | R/* | |||||||
ZK867.1f.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK867.1f.1:c.1036C>T | |||||||
HGVSp | CE53637:p.Arg346Ter | |||||||
cDNA_position | 1397 | |||||||
CDS_position | 1036 | |||||||
Protein_position | 346 | |||||||
Exon_number | 8/11 | |||||||
Codon_change | Cga/Tga | |||||||
Amino_acid_change | R/* | |||||||
ZK867.1b.2 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK867.1b.2:c.85C>T | |||||||
HGVSp | CE28198:p.Arg29Ter | |||||||
cDNA_position | 1362 | |||||||
CDS_position | 85 | |||||||
Protein_position | 29 | |||||||
Exon_number | 8/11 | |||||||
Codon_change | Cga/Tga | |||||||
Amino_acid_change | R/* | |||||||
ZK867.1c.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK867.1c.1:c.985C>T | |||||||
HGVSp | CE35819:p.Arg329Ter | |||||||
cDNA_position | 1181 | |||||||
CDS_position | 985 | |||||||
Protein_position | 329 | |||||||
Exon_number | 7/10 | |||||||
Codon_change | Cga/Tga | |||||||
Amino_acid_change | R/* | |||||||
ZK867.1e.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK867.1e.1:c.985C>T | |||||||
HGVSp | CE28199:p.Arg329Ter | |||||||
cDNA_position | 985 | |||||||
CDS_position | 985 | |||||||
Protein_position | 329 | |||||||
Exon_number | 6/8 | |||||||
Codon_change | Cga/Tga | |||||||
Amino_acid_change | R/* | |||||||
Genetics | Interpolated_map_position | X | -1.79055 | |||||
Mapping_data | In_multi_point | 5701 | ||||||
In_pos_neg_data | 10764 | |||||||
10765 | ||||||||
10766 | ||||||||
10767 | ||||||||
Description | Phenotype (17) | |||||||
Phenotype_not_observed | WBPhenotype:0000680 | Paper_evidence | WBPaper00027711 | |||||
Curator_confirmed | WBPerson48 | |||||||
Affected_by | Molecule | WBMol:00003650 | Paper_evidence | WBPaper00027711 | ||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0000905 | Paper_evidence | WBPaper00027711 | ||||||
Curator_confirmed | WBPerson48 | |||||||
Remark | visualized using panneuronal GFP marker, edIs20, and a GABAergic-specific GFP marker, juIs76 | Paper_evidence | WBPaper00027711 | |||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0000926 | Paper_evidence | WBPaper00027711 | ||||||
Curator_confirmed | WBPerson48 | |||||||
Remark | visualized by phalloidin staining | Paper_evidence | WBPaper00027711 | |||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0001310 | Paper_evidence | WBPaper00027711 | ||||||
Curator_confirmed | WBPerson48 | |||||||
Remark | visualized using panneuronal GFP marker, edIs20, and a GABAergic-specific GFP marker, juIs76 | Paper_evidence | WBPaper00027711 | |||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0001312 | Paper_evidence | WBPaper00027711 | ||||||
Curator_confirmed | WBPerson48 | |||||||
Remark | visualized using panneuronal GFP marker, edIs20, and a GABAergic-specific GFP marker, juIs76 | Paper_evidence | WBPaper00027711 | |||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0001320 | Paper_evidence | WBPaper00027711 | ||||||
Curator_confirmed | WBPerson48 | |||||||
Reference | WBPaper00027711 | |||||||
Method | Substitution_allele |