WormBase Tree Display for Variation: WBVar00088864

WBVar00088864 Evidence: Paper_evidence: WBPaper00026986
  Name: Public_name: me4
    Other_name: T07G12.12a.1:c.254C>T
      CE36715:p.Ser85Phe
    HGVSg: CHROMOSOME_IV:g.10562226C>T
  Sequence_details: SMap: S_parent: Sequence: T07G12
    Flanking_sequences: aattcacactgaatctttcggaaaaaatat cgaaattggaccgaacgacgagaacgaaga
    Mapping_target: T07G12
    Type_of_mutation: Substitution: c t Paper_evidence: WBPaper00026986
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00004043
      WBStrain00051718
    Laboratory: AV
    Status: Live
  Affects: Gene: WBGene00001867
    Transcript: T07G12.12a.1 VEP_consequence: missense_variant
        VEP_impact: MODERATE
        HGVSc: T07G12.12a.1:c.254C>T
        HGVSp: CE36715:p.Ser85Phe
        cDNA_position: 263
        CDS_position: 254
        Protein_position: 85
        Exon_number: 3/8
        Codon_change: tCc/tTc
        Amino_acid_change: S/F
  Genetics: Interpolated_map_position: IV 4.63921
  Description: Phenotype: WBPhenotype:0000436 Paper_evidence: WBPaper00035521
        Curator_confirmed: WBPerson712
        Remark: In him-8(me4) XX hermaphrodite germ lines the progression of RAD-51 focus formation and removal resembled fem-3(lf) X0 female germ lines and N2 X0 males where RAD-51 foci were shifted to later meiotic prophase substages and overall levels were higher. | As previously reported, H3dimethylK9 is found predominantly on the paired X chromosomes in N2 hermaphrodite germ lines and accumulates on the single X inmale and the asynapsed Xs in him-8 hermaphrodite germ lines. Paper_evidence: WBPaper00035521
            Curator_confirmed: WBPerson712
      WBPhenotype:0001175 Paper_evidence: WBPaper00026986
        Curator_confirmed: WBPerson48
        Penetrance: Complete: Paper_evidence: WBPaper00026986
              Curator_confirmed: WBPerson48
        Recessive: Paper_evidence: WBPaper00026986
          Curator_confirmed: WBPerson48
    Phenotype_not_observed: WBPhenotype:0000717 Paper_evidence: WBPaper00035521
        Curator_confirmed: WBPerson712
        Remark: N2 XX and him-8(me4) XX hermaphrodites exhibited expression of two X-linked oocyte-enriched genes, which are activated in late pachytene in hermaphrodites in late pachytene extending to diakinesis. Paper_evidence: WBPaper00035521
            Curator_confirmed: WBPerson712
      WBPhenotype:0001348 Paper_evidence: WBPaper00035521
        Curator_confirmed: WBPerson712
        Remark: Analysis of H3dimethylK4 showed that indeed this activating mark accumulated on the X chromosomes in both N2 and him-8(me4) hermaphrodites late in pachytene and was maintained through diakinesis. Paper_evidence: WBPaper00035521
            Curator_confirmed: WBPerson712
  Reference: WBPaper00035521
    WBPaper00026986
    WBPaper00065003
  Remark: Allele mistakenly described as ay29 instead of me4. Paper_evidence: WBPaper00004597
  Method: Substitution_allele