WormBase Tree Display for Variation: WBVar00088923
expand all nodes | collapse all nodes | view schema
WBVar00088923 | Evidence | Paper_evidence | WBPaper00003903 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | mg280 | |||||||
Other_name | ZK1290.2a.1:c.86+68_854del | ||||||||
ZK1290.2b.1:c.-264+68_545del | |||||||||
HGVSg | CHROMOSOME_II:g.7549511_7550816del | ||||||||
Sequence_details | SMap | S_parent | Sequence | ZK1290 | |||||
Flanking_sequences | ccgttcaattttgaactgtaggagtgaact | atactcggaaaataatattccgcaactaga | |||||||
Mapping_target | ZK1290 | ||||||||
Type_of_mutation | Deletion | ||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00006655 | ||||||||
WBStrain00007901 | |||||||||
WBStrain00027519 | |||||||||
WBStrain00049490 | |||||||||
WBStrain00055118 | |||||||||
WBStrain00055121 | |||||||||
Laboratory | GR | ||||||||
MT | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00197293 | |||||||
WBGene00006600 | |||||||||
Transcript (3) | |||||||||
Interactor | WBInteraction000500144 | ||||||||
WBInteraction000502728 | |||||||||
WBInteraction000525337 | |||||||||
WBInteraction000537565 | |||||||||
WBInteraction000537566 | |||||||||
WBInteraction000541577 | |||||||||
Genetics | Interpolated_map_position | II | 0.504577 | ||||||
Mapping_data | In_multi_point | 4733 | |||||||
Description | Phenotype (45) | ||||||||
Phenotype_not_observed | WBPhenotype:0000306 | Paper_evidence | WBPaper00050142 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "As a control for the specificity of serotonergic signaling to neuronal and cell-non-autonomous induction of the response, we exposed tph-1 mutant animals to cell-autonomous stressors, namely paraquat and cco-1 RNAi. These strains showed the same level of induction of hsp-6::GFP as controls, indicating that serotonin is required specifically for neuronal initiation of this response (Figure S4D)." | Paper_evidence | WBPaper00050142 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00002747 | Paper_evidence | WBPaper00050142 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | GO_term | GO:0034514 | PATO:0000460 | Paper_evidence | WBPaper00050142 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype (2) | ||||||||
WBPhenotype:0000631 | Paper_evidence | WBPaper00035198 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals do not exhibit anterior convulsions when treated with pentylenetetrazole(PTZ). | Paper_evidence | WBPaper00035198 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00004251 | Paper_evidence | WBPaper00035198 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001068 | Paper_evidence | WBPaper00031241 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Pre-exposure to mianserin blocked serotonin-induced egg laying as it does for N2 animals. | Paper_evidence | WBPaper00031241 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00031241 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were pre-exposed to 50uM mianserin. | Paper_evidence | WBPaper00031241 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001072 | Paper_evidence | WBPaper00035327 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | tph-1 mutants displayed a wild type phenotype on non-eatable food | Paper_evidence | WBPaper00035327 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001101 | Paper_evidence | WBPaper00038382 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Clozapine-induced increases in egg laying was present. | Paper_evidence | WBPaper00038382 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003634 | Paper_evidence | WBPaper00038382 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001765 | Paper_evidence | WBPaper00031936 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants defective in the synthesis and reception of nonessential excitatory neurotransmitters respond normally to CO2 | Paper_evidence | WBPaper00031936 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00031936 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | 10% CO2 | Paper_evidence | WBPaper00031936 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001780 | Paper_evidence | WBPaper00029060 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants show normal butanone enhancement | Paper_evidence | WBPaper00029060 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00029060 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Preexposure to 1:10 dilution of butanone and food. Animals were then subjected to odorant chemotaxis assays and/or selection assays | Paper_evidence | WBPaper00029060 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001817 | Paper_evidence | WBPaper00032335 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibited enhanced-gustatory plasticity, i.e. strong avoidance to NaCl after starvation, similar to that observed for wild type. | Paper_evidence | WBPaper00032335 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003571 | Paper_evidence | WBPaper00032335 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Disease_info | Models_disease | DOID:809 | |||||||
DOID:1574 | |||||||||
Models_disease_in_annotation | WBDOannot00000681 | ||||||||
WBDOannot00000714 | |||||||||
Reference (41) | |||||||||
Remark | Variation stub generated from the April 2021 NN VFP dataset. | ||||||||
Variation stub/paper connection generated from the May 2021 NN VFP dataset. | |||||||||
Created by WBPerson1983 from the NN_VFP_triage_pipeline | |||||||||
Method | Deletion_allele |