WormBase Tree Display for Variation: WBVar00088923
expand all nodes | collapse all nodes | view schema
WBVar00088923 | Evidence | Paper_evidence | WBPaper00003903 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | mg280 | |||||||
Other_name | ZK1290.2a.1:c.86+68_854del | ||||||||
ZK1290.2b.1:c.-264+68_545del | |||||||||
HGVSg | CHROMOSOME_II:g.7549511_7550816del | ||||||||
Sequence_details | SMap | S_parent | Sequence | ZK1290 | |||||
Flanking_sequences | ccgttcaattttgaactgtaggagtgaact | atactcggaaaataatattccgcaactaga | |||||||
Mapping_target | ZK1290 | ||||||||
Type_of_mutation | Deletion | ||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00006655 | ||||||||
WBStrain00007901 | |||||||||
WBStrain00027519 | |||||||||
WBStrain00049490 | |||||||||
WBStrain00055118 | |||||||||
WBStrain00055121 | |||||||||
Laboratory | GR | ||||||||
MT | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00197293 | |||||||
WBGene00006600 | |||||||||
Transcript | ZK1290.2b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZK1290.2b.1:c.-264+68_545del | ||||||||
cDNA_position | ?-875 | ||||||||
CDS_position | ?-545 | ||||||||
Protein_position | ?-182 | ||||||||
Intron_number | 1-6/11 | ||||||||
Exon_number | 2-7/12 | ||||||||
ZK1290.2a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZK1290.2a.1:c.86+68_854del | ||||||||
cDNA_position | ?-877 | ||||||||
CDS_position | ?-854 | ||||||||
Protein_position | ?-285 | ||||||||
Intron_number | 2-7/12 | ||||||||
Exon_number | 3-8/13 | ||||||||
ZK1290.18 | VEP_consequence | non_coding_transcript_exon_variant | |||||||
VEP_impact | MODIFIER | ||||||||
cDNA_position | ?-74 | ||||||||
Exon_number | 1/1 | ||||||||
Interactor | WBInteraction000500144 | ||||||||
WBInteraction000502728 | |||||||||
WBInteraction000525337 | |||||||||
WBInteraction000537565 | |||||||||
WBInteraction000537566 | |||||||||
WBInteraction000541577 | |||||||||
Genetics | Interpolated_map_position | II | 0.504577 | ||||||
Mapping_data | In_multi_point | 4733 | |||||||
Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00031438 | |||||
Curator_confirmed | WBPerson2369 | ||||||||
WBPhenotype:0000010 | Paper_evidence | WBPaper00036766 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The tph-1(mg280) mutant was fully sensitive to fluoxetine-induced paralysis. | Fluoxetine caused muscle relaxation in tph-1 mutants. | Paper_evidence | WBPaper00036766 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00005058 | Paper_evidence | WBPaper00036766 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000019 | Paper_evidence | WBPaper00032067 | |||||||
WBPaper00033168 | |||||||||
WBPaper00045372 | |||||||||
WBPaper00050740 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2021 | |||||||||
WBPerson2987 | |||||||||
Remark | The deficiency in endogenous serotonin caused a 40% reduction in pharynx pump rate. | Paper_evidence | WBPaper00032067 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
The tph-1(mg280) strain shows a slight, but significant, reduction in the basal rate of pharyngeal pumping on food as compared to controls | Paper_evidence | WBPaper00033168 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
C. elegans tph-1 mutants exhibited significantly lower pharyngeal pumping rates than N2 control animals (A, N2 =3.46 0.19 Hz; tph-1 = 0.89 0.10 Hz; mean SEM; *** p < 0.0001, 2-tailed students t-test). | Paper_evidence | WBPaper00050740 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Image | WBPicture0000013537 | Paper_evidence | WBPaper00050740 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003681 | PATO:0000460 | Paper_evidence | WBPaper00032067 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00032067 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Pharyngeal pumping was measure in the presence of 100 mg/ml E. coli OP50 in M9 buffer, following a 2-hr fasting period. | Paper_evidence | WBPaper00050740 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 25 | Paper_evidence | WBPaper00032067 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000022 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000039 | Paper_evidence | WBPaper00031694 | |||||||
WBPaper00048926 | |||||||||
Curator_confirmed | WBPerson8126 | ||||||||
WBPerson11689 | |||||||||
Remark | Fig.4 partial reduction in lifespan extension compared to N2 wildtype upon reserpine treatment | Paper_evidence | WBPaper00031694 | ||||||
Curator_confirmed | WBPerson8126 | ||||||||
resistant to lifespan extension by serotonin antagonists (mianserin, etc) | Paper_evidence | WBPaper00048926 | |||||||
Curator_confirmed | WBPerson11689 | ||||||||
Affected_by | Molecule | WBMol:00002955 | Paper_evidence | WBPaper00031694 | |||||
Curator_confirmed | WBPerson8126 | ||||||||
WBMol:00003509 | Paper_evidence | WBPaper00048926 | |||||||
Curator_confirmed | WBPerson11689 | ||||||||
WBPhenotype:0000061 | Paper_evidence | WBPaper00031241 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | In the absence of drug, animals have a 4% extended life-span (24.4 days n=547) compared to N2 (23.5 days n=546). | Paper_evidence | WBPaper00031241 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00031241 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000142 | Paper_evidence | WBPaper00048926 | |||||||
Curator_confirmed | WBPerson11689 | ||||||||
Remark | resistant to induction of stress resistance by serotonin antagonists (mianserin, etc) | Paper_evidence | WBPaper00048926 | ||||||
Curator_confirmed | WBPerson11689 | ||||||||
Affected_by | Molecule | WBMol:00003509 | Paper_evidence | WBPaper00048926 | |||||
Curator_confirmed | WBPerson11689 | ||||||||
WBPhenotype:0000147 | Paper_evidence | WBPaper00035327 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Unlike WT, well-fed and fasted tph-1 mutants failed to show significantly different behaviors | Paper_evidence | WBPaper00035327 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000353 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000545 | Paper_evidence | WBPaper00028900 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0000577 | Paper_evidence | WBPaper00031915 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Oxygen consumption in mutants is reduced by 30% compared to wild-type controls | Paper_evidence | WBPaper00031915 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031915 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000637 | Paper_evidence | WBPaper00042548 | |||||||
Curator_confirmed | WBPerson237 | ||||||||
Remark | Figure 1, 2 and 3 | Paper_evidence | WBPaper00042548 | ||||||
Curator_confirmed | WBPerson237 | ||||||||
WBPhenotype:0001013 | Paper_evidence | WBPaper00035315 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | tph-1(mg280) exhibited enhanced susceptibility to PA14 relative to WT worms on the standard lawn assay | Paper_evidence | WBPaper00035315 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00035315 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001042 | Paper_evidence | WBPaper00032221 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | VC neurons showed reduced activity, as demonstrated by a significantly low frequency of calcium spikes compared to wild-type animals. | Paper_evidence | WBPaper00032221 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005304 | PATO:0000460 | Paper_evidence | WBPaper00032221 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were tested in low osmolarity conditions. Animals were assayed 24 hr after the late fourth larval (L4) stage at 20.5C 0.5C. | Paper_evidence | WBPaper00032221 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | Cameleon IjIs25[myo-3::YC2.0] | Paper_evidence | WBPaper00032221 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001183 | Paper_evidence | WBPaper00045372 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001265 | Paper_evidence | WBPaper00042154 | |||||||
Curator_confirmed | WBPerson1455 | ||||||||
Remark | In free locomotion, head swing is highly irregular (Fig. 3), and head movement and body center movement are uncoordinated (Fig. 7). | Paper_evidence | WBPaper00042154 | ||||||
Curator_confirmed | WBPerson1455 | ||||||||
WBPhenotype:0001278 | Paper_evidence | WBPaper00050142 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Consistent with a role for serotonin in mediating the response to mitochondrial stress in the nervous system, mutations in tryptophan hydroxylase (tph-1), a key enzyme for serotonin synthesis, suppressed the induction of the hsp-6p::GFP reporter in the neuronal polyQ expressing animals (Figures 5A and 5B)." | Paper_evidence | WBPaper00050142 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
"We found that loss of serotonin, by mutation of tph-1, blocked induction of the UPRmt in the spg-7 neuronal mutant model (Figures 6D and 6E)." | Paper_evidence | WBPaper00050142 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | GO_term | GO:0034514 | PATO:0000460 | Paper_evidence | WBPaper00050142 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | rmIs101 [rgef-1p::Q40::YFP]; zcIs13 [hsp-6p::GFP] | Paper_evidence | WBPaper00050142 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
rab-3p::Cas9; u6p::spg-7-sg; zcIs13 [hsp-6p::GFP] | Paper_evidence | WBPaper00050142 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001444 | Paper_evidence | WBPaper00032335 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibited defective gustatory plasticity of NaCl. | Paper_evidence | WBPaper00032335 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003571 | Paper_evidence | WBPaper00032335 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were tested for response to 25 mM NaCl after various pre-treatments: a 15-min wash in CTX buffer with or without 100 mM NaCl (liquid), or 30 min on a CTX plate with or without 100 mM NaCl, and in the presence or absence of bacteria, 500 mM glycerol, or 3 uL of benzaldehyde. | Paper_evidence | WBPaper00032335 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001462 | Paper_evidence | WBPaper00032335 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals showed significantly stronger chemotaxis to 1mM NaCl than wild-type animals. | Paper_evidence | WBPaper00032335 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003571 | Paper_evidence | WBPaper00032335 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were tested for response to 25 mM NaCl. | Paper_evidence | WBPaper00032335 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001602 | Paper_evidence | WBPaper00031241 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Methiothepin did not extend the life-span of animals (-2% increase, n=63) as observed for N2 animals (28% increase, n=273). | Paper_evidence | WBPaper00031241 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00031241 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were exposed to 10uM methiothepin on day 1 of adulthood. | Paper_evidence | WBPaper00031241 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001604 | Paper_evidence | WBPaper00031241 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mianserin did not extend the life-span of animals (1% increase, n=314) as observed for N2 animals (31% increase, n=1180). | Paper_evidence | WBPaper00031241 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00031241 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were exposed to 50uM mianserin starting day 1 of adulthood. | Paper_evidence | WBPaper00031241 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001639 | Paper_evidence | WBPaper00035327 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Serotonin deficient tph-1 mutants were strongly defective in roaming | Paper_evidence | WBPaper00035327 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001740 | Paper_evidence | WBPaper00032067 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Pharyngeal senescence was accelerated in these animals; however the normal pattern of morphological change was not altered compared with control animals, based on an aging model built on pharynx images from adults days 0-12. In this study fem-1(hc17) was the control. | Paper_evidence | WBPaper00032067 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003681 | PATO:0000460 | Paper_evidence | WBPaper00032067 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00032067 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 25 | Paper_evidence | WBPaper00032067 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001818 | Paper_evidence | WBPaper00032221 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | HSN neurons showed hyperactivity, as demonstrated by increased calcium spike frequency compared to wild-type animals even in high osmolarity conditions. | Paper_evidence | WBPaper00032221 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00032221 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were tested in both low and osmolarity conditions. Animals were assayed 24 hr after the late fourth larval (L4) stage at 20.5C 0.5C. | Paper_evidence | WBPaper00032221 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | Cameleon IjIs25[myo-3::YC2.0] | Paper_evidence | WBPaper00032221 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001842 | Paper_evidence | WBPaper00033168 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | tph-1 animals did not show an overshoot in pharyngeal pumping following drug withdrawal, unlike N2 | Paper_evidence | WBPaper00033168 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Animals were treated with Clozapine (200 uM), fluphenazine (80 uM), or trifluoperazine (40 uM) | Paper_evidence | WBPaper00033168 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001905 | Paper_evidence | WBPaper00028900 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0001911 | Paper_evidence | WBPaper00049131 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | We confirmed that a loss-of-function mutation (mg280) of tph-1 caused a defect in axon regeneration in touch sensory posterior lateral microtubule (PLM) neurons. Furthermore, the mg280 and n4622 mutations of tph-1 were also defective in axon regeneration in GABA-releasing D-type motor neurons (Fig. 1d and Supplementary Table 2). Exogenous 5-HT treatment restored axon regeneration in tph-1mutants. These results suggest that 5-HT is generally required during axon regeneration. A single floxed copy of the tph-1 inserted gene was able to rescue the tph-1 defect in axon regeneration of D-type motorneurons. Expression of tph-1 in D neurons did indeed suppress the defect in axon regeneration of tph-1 mutants | Paper_evidence | WBPaper00049131 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Rescued_by_transgene | WBTransgene00018707 | ||||||||
WBTransgene00022921 | |||||||||
Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00049131 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00004929 | Paper_evidence | WBPaper00049131 | |||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005190 | PATO:0000460 | Paper_evidence | WBPaper00049131 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005490 | PATO:0000460 | Paper_evidence | WBPaper00049131 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005270 | PATO:0000460 | Paper_evidence | WBPaper00049131 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005303 | PATO:0000460 | Paper_evidence | WBPaper00049131 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002284 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002288 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002293 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002296 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002300 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002303 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002309 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002313 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002319 | Paper_evidence | WBPaper00044094 | |||||||
Curator_confirmed | WBPerson23309 | ||||||||
WBPhenotype:0002322 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002325 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002328 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002335 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002346 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002378 | Paper_evidence | WBPaper00049802 | |||||||
Curator_confirmed | WBPerson12526 | ||||||||
WBPhenotype:0002506 | Paper_evidence | WBPaper00044624 | |||||||
Curator_confirmed | WBPerson2706 | ||||||||
Remark | mg280 clears labelled M. nematophilum infections faster than wild type | Paper_evidence | WBPaper00044624 | ||||||
Curator_confirmed | WBPerson2706 | ||||||||
WBPhenotype:0004017 | Paper_evidence | WBPaper00042154 | |||||||
Curator_confirmed | WBPerson1455 | ||||||||
Remark | In free locomotion, head swing is highly irregular (Fig. 3), and head movement and body center movement are uncoordinated (Fig. 7). | Paper_evidence | WBPaper00042154 | ||||||
Curator_confirmed | WBPerson1455 | ||||||||
WBPhenotype:0004023 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_not_observed | WBPhenotype:0000306 | Paper_evidence | WBPaper00050142 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "As a control for the specificity of serotonergic signaling to neuronal and cell-non-autonomous induction of the response, we exposed tph-1 mutant animals to cell-autonomous stressors, namely paraquat and cco-1 RNAi. These strains showed the same level of induction of hsp-6::GFP as controls, indicating that serotonin is required specifically for neuronal initiation of this response (Figure S4D)." | Paper_evidence | WBPaper00050142 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00002747 | Paper_evidence | WBPaper00050142 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | GO_term | GO:0034514 | PATO:0000460 | Paper_evidence | WBPaper00050142 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | zcIs13 [hsp-6p::GFP] | Paper_evidence | WBPaper00050142 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
zcIs13 [hsp-6p::GFP]; cco-1(RNAi) | Paper_evidence | WBPaper00050142 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000631 | Paper_evidence | WBPaper00035198 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals do not exhibit anterior convulsions when treated with pentylenetetrazole(PTZ). | Paper_evidence | WBPaper00035198 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00004251 | Paper_evidence | WBPaper00035198 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001068 | Paper_evidence | WBPaper00031241 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Pre-exposure to mianserin blocked serotonin-induced egg laying as it does for N2 animals. | Paper_evidence | WBPaper00031241 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00031241 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were pre-exposed to 50uM mianserin. | Paper_evidence | WBPaper00031241 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001072 | Paper_evidence | WBPaper00035327 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | tph-1 mutants displayed a wild type phenotype on non-eatable food | Paper_evidence | WBPaper00035327 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001101 | Paper_evidence | WBPaper00038382 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Clozapine-induced increases in egg laying was present. | Paper_evidence | WBPaper00038382 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003634 | Paper_evidence | WBPaper00038382 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001765 | Paper_evidence | WBPaper00031936 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants defective in the synthesis and reception of nonessential excitatory neurotransmitters respond normally to CO2 | Paper_evidence | WBPaper00031936 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00031936 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | 10% CO2 | Paper_evidence | WBPaper00031936 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001780 | Paper_evidence | WBPaper00029060 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants show normal butanone enhancement | Paper_evidence | WBPaper00029060 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00029060 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Preexposure to 1:10 dilution of butanone and food. Animals were then subjected to odorant chemotaxis assays and/or selection assays | Paper_evidence | WBPaper00029060 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001817 | Paper_evidence | WBPaper00032335 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibited enhanced-gustatory plasticity, i.e. strong avoidance to NaCl after starvation, similar to that observed for wild type. | Paper_evidence | WBPaper00032335 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003571 | Paper_evidence | WBPaper00032335 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Disease_info | Models_disease | DOID:809 | |||||||
DOID:1574 | |||||||||
Models_disease_in_annotation | WBDOannot00000681 | ||||||||
WBDOannot00000714 | |||||||||
Reference | WBPaper00038382 | ||||||||
WBPaper00043908 | |||||||||
WBPaper00031936 | |||||||||
WBPaper00035198 | |||||||||
WBPaper00032221 | |||||||||
WBPaper00036766 | |||||||||
WBPaper00029060 | |||||||||
WBPaper00035327 | |||||||||
WBPaper00003903 | |||||||||
WBPaper00018301 | |||||||||
WBPaper00025798 | |||||||||
WBPaper00010687 | |||||||||
WBPaper00031241 | |||||||||
WBPaper00031694 | |||||||||
WBPaper00031915 | |||||||||
WBPaper00032335 | |||||||||
WBPaper00028900 | |||||||||
WBPaper00031438 | |||||||||
WBPaper00032067 | |||||||||
WBPaper00033168 | |||||||||
WBPaper00019518 | |||||||||
WBPaper00025761 | |||||||||
WBPaper00035315 | |||||||||
WBPaper00019020 | |||||||||
WBPaper00019156 | |||||||||
WBPaper00024107 | |||||||||
WBPaper00042548 | |||||||||
WBPaper00042154 | |||||||||
WBPaper00044094 | |||||||||
WBPaper00044624 | |||||||||
WBPaper00045372 | |||||||||
WBPaper00048926 | |||||||||
WBPaper00049131 | |||||||||
WBPaper00050142 | |||||||||
WBPaper00050740 | |||||||||
WBPaper00049802 | |||||||||
WBPaper00059382 | |||||||||
WBPaper00060921 | |||||||||
WBPaper00064927 | |||||||||
WBPaper00065802 | |||||||||
WBPaper00065715 | |||||||||
Remark | Variation stub generated from the April 2021 NN VFP dataset. | ||||||||
Variation stub/paper connection generated from the May 2021 NN VFP dataset. | |||||||||
Created by WBPerson1983 from the NN_VFP_triage_pipeline | |||||||||
Method | Deletion_allele |