WormBase Tree Display for Variation: WBVar00090850
expand all nodes | collapse all nodes | view schema
WBVar00090850 | Evidence | Paper_evidence | WBPaper00031335 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | n4504 | |||||||
Sequence_details | SMap | S_parent | Sequence | T09B4 | |||||
Flanking_sequences | ATCGGCCATCAGAACAGTGCAAGAAAT | GTCATCTGAAGAAAGGACACACATACATA | |||||||
Mapping_target | T09B4 | ||||||||
Type_of_mutation | Deletion | ||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00027584 | ||||||||
Laboratory | MT | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003328 | |||||||
Transcript | T09B4.12 | ||||||||
Interactor | WBInteraction000520120 | ||||||||
WBInteraction000520121 | |||||||||
WBInteraction000520122 | |||||||||
WBInteraction000520124 | |||||||||
Isolation | Mutagen | EMS | Paper_evidence | WBPaper00031335 | |||||
Genetics | Interpolated_map_position | I | 0.842497 | ||||||
Description | Phenotype | WBPhenotype:0001837 | Paper_evidence | WBPaper00056404 | |||||
Curator_confirmed | WBPerson10332 | ||||||||
Remark | mir-235 mutation suppresses the dietary restriction-induced longevity but has no effect on the wild type lifespan | Paper_evidence | WBPaper00056404 | ||||||
Curator_confirmed | WBPerson10332 | ||||||||
Phenotype_not_observed | WBPhenotype:0000006 | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | non-Egl | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000207 | Paper_evidence | WBPaper00031335 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Defecation cycle is normal | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000634 | Paper_evidence | WBPaper00031335 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Pumping is normal | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000637 | Paper_evidence | WBPaper00031335 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | No defects in dauer formation | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00031335 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | non-Unc | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001233 | Paper_evidence | WBPaper00031335 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Cell number and nuclear staining is normal | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | DAPI staining | Paper_evidence | WBPaper00031335 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0002535 | Paper_evidence | WBPaper00031335 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | non-Dyf | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005666 | PATO:0000460 | Paper_evidence | WBPaper00031335 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0005667 | PATO:0000460 | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0005668 | PATO:0000460 | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0005665 | PATO:0000460 | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0005661 | PATO:0000460 | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0007807 | PATO:0000460 | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0007808 | PATO:0000460 | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | DiO staining | Paper_evidence | WBPaper00031335 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00031335 | ||||||||
WBPaper00056404 | |||||||||
Method | Deletion_allele |