WormBase Tree Display for Variation: WBVar00091489
expand all nodes | collapse all nodes | view schema
WBVar00091489 | Evidence | Person_evidence | WBPerson7734 | ||
---|---|---|---|---|---|
Name (3) | |||||
Sequence_details | SMap | S_parent | Sequence | M79 | |
Flanking_sequences | ggatgcattttaacatacgtactcgagttc | cggaatttgacttcttgtgtgatgaacatc | |||
Mapping_target | M79 | ||||
Type_of_mutation | Deletion | ||||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00040670 | ||||
WBStrain00040671 | |||||
WBStrain00040673 | |||||
Laboratory | RB | ||||
FB | |||||
Person | WBPerson46 | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00000018 | |||
Transcript | M79.1f.1 (11) | ||||
M79.1c.1 (11) | |||||
M79.1e.1 (11) | |||||
M79.1d.1 (11) | |||||
M79.1g.1 (11) | |||||
M79.1a.1 (11) | |||||
M79.1b.1 (11) | |||||
Genetics | Mapping_data | In_multi_point | 4134 | ||
Description (2) | |||||
Reference | WBPaper00024301 | ||||
WBPaper00027700 | |||||
WBPaper00017950 | |||||
WBPaper00032243 | |||||
WBPaper00033433 | |||||
WBPaper00010154 | |||||
Remark | Last updated on 29 Nov 2002 | ||||
Generated by the C. elegans Gene Knockout Consortium | |||||
Knockout originally requested for M79.1 before it was renamed to M79.1a | |||||
Allele sequenced by Elizabeth Marsh | Curator_confirmed | WBPerson2970 | |||
Method | KO_consortium_allele |