WormBase Tree Display for Variation: WBVar00091489

WBVar00091489 Evidence: Person_evidence: WBPerson7734
  Name: Public_name: ok171
    Other_name (14)
    HGVSg: CHROMOSOME_X:g.10609441_10611936del
  Sequence_details: SMap: S_parent: Sequence: M79
    Flanking_sequences: ggatgcattttaacatacgtactcgagttc cggaatttgacttcttgtgtgatgaacatc
    Mapping_target: M79
    Type_of_mutation: Deletion
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00040670
      WBStrain00040671
      WBStrain00040673
    Laboratory: RB
      FB
    Person: WBPerson46
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00000018
    Transcript: M79.1f.1 (11)
      M79.1c.1 (11)
      M79.1e.1 (11)
      M79.1d.1 (11)
      M79.1g.1 (11)
      M79.1a.1 (11)
      M79.1b.1 (11)
  Genetics: Mapping_data: In_multi_point: 4134
  Description (2)
  Reference (6)
  Remark: Last updated on 29 Nov 2002
    Generated by the C. elegans Gene Knockout Consortium
    Knockout originally requested for M79.1 before it was renamed to M79.1a
    Allele sequenced by Elizabeth Marsh Curator_confirmed: WBPerson2970
  Method: KO_consortium_allele