WormBase Tree Display for Variation: WBVar00091489
expand all nodes | collapse all nodes | view schema
| WBVar00091489 | Evidence | Person_evidence | WBPerson7734 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | ok171 | |||||||
| Other_name (14) | |||||||||
| HGVSg | CHROMOSOME_X:g.10609441_10611936del | ||||||||
| Sequence_details | SMap | S_parent | Sequence | M79 | |||||
| Flanking_sequences | ggatgcattttaacatacgtactcgagttc | cggaatttgacttcttgtgtgatgaacatc | |||||||
| Mapping_target | M79 | ||||||||
| Type_of_mutation | Deletion | ||||||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00040670 | ||||||||
| WBStrain00040671 | |||||||||
| WBStrain00040673 | |||||||||
| Laboratory (2) | |||||||||
| Person | WBPerson46 | ||||||||
| KO_consortium_allele | |||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00000018 | |||||||
| Transcript | M79.1f.1 (11) | ||||||||
| M79.1c.1 (11) | |||||||||
| M79.1e.1 (11) | |||||||||
| M79.1d.1 (11) | |||||||||
| M79.1g.1 (11) | |||||||||
| M79.1a.1 (11) | |||||||||
| M79.1b.1 (11) | |||||||||
| Genetics | Mapping_data | In_multi_point | 4134 | ||||||
| Description | Phenotype (5) | ||||||||
| Phenotype_not_observed | WBPhenotype:0001851 | Paper_evidence | WBPaper00027700 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | Mutants did not display significant radiosensitivity when compared with WT N2 C. elegans | Paper_evidence | WBPaper00027700 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0006748 | PATO:0000460 | Paper_evidence | WBPaper00027700 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00027700 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_assay | Treatment | 100-400 Gy radiation | Paper_evidence | WBPaper00027700 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Reference | WBPaper00024301 | ||||||||
| WBPaper00027700 | |||||||||
| WBPaper00017950 | |||||||||
| WBPaper00032243 | |||||||||
| WBPaper00033433 | |||||||||
| WBPaper00010154 | |||||||||
| Remark | Last updated on 29 Nov 2002 | ||||||||
| Generated by the C. elegans Gene Knockout Consortium | |||||||||
| Knockout originally requested for M79.1 before it was renamed to M79.1a | |||||||||
| Allele sequenced by Elizabeth Marsh | Curator_confirmed | WBPerson2970 | |||||||
| Method | KO_consortium_allele |
