WormBase Tree Display for Variation: WBVar00091489
expand all nodes | collapse all nodes | view schema
WBVar00091489 | Evidence | Person_evidence | WBPerson7734 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ok171 | |||||||
Other_name (14) | |||||||||
HGVSg | CHROMOSOME_X:g.10609441_10611936del | ||||||||
Sequence_details | SMap | S_parent | Sequence | M79 | |||||
Flanking_sequences | ggatgcattttaacatacgtactcgagttc | cggaatttgacttcttgtgtgatgaacatc | |||||||
Mapping_target | M79 | ||||||||
Type_of_mutation | Deletion | ||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00040670 | ||||||||
WBStrain00040671 | |||||||||
WBStrain00040673 | |||||||||
Laboratory (2) | |||||||||
Person | WBPerson46 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000018 | |||||||
Transcript | M79.1f.1 (11) | ||||||||
M79.1c.1 (11) | |||||||||
M79.1e.1 (11) | |||||||||
M79.1d.1 (11) | |||||||||
M79.1g.1 (11) | |||||||||
M79.1a.1 (11) | |||||||||
M79.1b.1 (11) | |||||||||
Genetics | Mapping_data | In_multi_point | 4134 | ||||||
Description | Phenotype (5) | ||||||||
Phenotype_not_observed | WBPhenotype:0001851 | Paper_evidence | WBPaper00027700 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants did not display significant radiosensitivity when compared with WT N2 C. elegans | Paper_evidence | WBPaper00027700 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006748 | PATO:0000460 | Paper_evidence | WBPaper00027700 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00027700 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | 100-400 Gy radiation | Paper_evidence | WBPaper00027700 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00024301 | ||||||||
WBPaper00027700 | |||||||||
WBPaper00017950 | |||||||||
WBPaper00032243 | |||||||||
WBPaper00033433 | |||||||||
WBPaper00010154 | |||||||||
Remark | Last updated on 29 Nov 2002 | ||||||||
Generated by the C. elegans Gene Knockout Consortium | |||||||||
Knockout originally requested for M79.1 before it was renamed to M79.1a | |||||||||
Allele sequenced by Elizabeth Marsh | Curator_confirmed | WBPerson2970 | |||||||
Method | KO_consortium_allele |