WormBase Tree Display for Variation: WBVar00091489
expand all nodes | collapse all nodes | view schema
WBVar00091489 | Evidence | Person_evidence | WBPerson7734 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ok171 | |||||||
Other_name (14) | |||||||||
HGVSg | CHROMOSOME_X:g.10609441_10611936del | ||||||||
Sequence_details | SMap | S_parent | Sequence | M79 | |||||
Flanking_sequences | ggatgcattttaacatacgtactcgagttc | cggaatttgacttcttgtgtgatgaacatc | |||||||
Mapping_target | M79 | ||||||||
Type_of_mutation | Deletion | ||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00040670 | ||||||||
WBStrain00040671 | |||||||||
WBStrain00040673 | |||||||||
Laboratory (2) | |||||||||
Person | WBPerson46 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000018 | |||||||
Transcript | M79.1f.1 (11) | ||||||||
M79.1c.1 (11) | |||||||||
M79.1e.1 (11) | |||||||||
M79.1d.1 (11) | |||||||||
M79.1g.1 (11) | |||||||||
M79.1a.1 (11) | |||||||||
M79.1b.1 (11) | |||||||||
Genetics | Mapping_data | In_multi_point | 4134 | ||||||
Description | Phenotype | WBPhenotype:0000386 | Paper_evidence | WBPaper00033433 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Copper-induced germ cell apoptosis was slightly increased in abl-1(ok171) mutants (Figure 3B). | Paper_evidence | WBPaper00033433 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00002862 | Paper_evidence | WBPaper00033433 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | Worms were exposed to 10 micromolar of copper for 12 hours | Paper_evidence | WBPaper00033433 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000436 | Paper_evidence | WBPaper00032243 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals showed an increase in intensity of nuclear CED-4 staining, indicative of nuclear CED-4 redistribution, after irradiation. | Paper_evidence | WBPaper00032243 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032243 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005175 | PATO:0000460 | Paper_evidence | WBPaper00032243 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | After animals were exposed to 120 Gy, germ cells were released from gonads and stained with antibodies against C. elegans CED-4 and Ce-lamin. | Paper_evidence | WBPaper00032243 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000730 | Paper_evidence | WBPaper00032243 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals displayed increased baseline germ cell death. | Paper_evidence | WBPaper00032243 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032243 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005175 | PATO:0000460 | Paper_evidence | WBPaper00032243 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Germ cell corpses were counted after 120Gy. Data (meanSEM) are collated from 10-15 worms/group. | Paper_evidence | WBPaper00032243 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001391 | Paper_evidence | WBPaper00032243 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals showed an increase in radiation-induced germ cell apoptosis. | Paper_evidence | WBPaper00032243 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032243 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005784 | PATO:0000460 | Paper_evidence | WBPaper00032243 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Germ cell corpses were counted after 120Gy. Data (meanSEM) are collated from 10-15 worms/group. | Paper_evidence | WBPaper00032243 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001742 | Paper_evidence | WBPaper00032243 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals showed prominent mitochondrial perinuclear distribution of ceramide upon irradiation. | Paper_evidence | WBPaper00032243 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032243 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005175 | PATO:0000460 | Paper_evidence | WBPaper00032243 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Gonads from unirradiated or irradiated worms were dissected, opened by freeze-cracking, and then stained with MID15B4, a specific anti-ceramide antibody. Mitochondria were localized with an antibody to the mitochondrial marker protein OxPhos Complex IV subunit I (COX-IV) or by Rhodamine B staining. | Paper_evidence | WBPaper00032243 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0001851 | Paper_evidence | WBPaper00027700 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants did not display significant radiosensitivity when compared with WT N2 C. elegans | Paper_evidence | WBPaper00027700 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006748 | PATO:0000460 | Paper_evidence | WBPaper00027700 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00027700 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | 100-400 Gy radiation | Paper_evidence | WBPaper00027700 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference (6) | |||||||||
Remark | Last updated on 29 Nov 2002 | ||||||||
Generated by the C. elegans Gene Knockout Consortium | |||||||||
Knockout originally requested for M79.1 before it was renamed to M79.1a | |||||||||
Allele sequenced by Elizabeth Marsh | Curator_confirmed | WBPerson2970 | |||||||
Method | KO_consortium_allele |