WormBase Tree Display for Variation: WBVar00091568
expand all nodes | collapse all nodes | view schema
| WBVar00091568 | Evidence | Paper_evidence | WBPaper00031112 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | ok268 | |||||||
| Other_name (12) | |||||||||
| HGVSg | CHROMOSOME_IV:g.17121871_17123529del | ||||||||
| Sequence_details | SMap | S_parent | Sequence | Y116A8C | |||||
| Flanking_sequences | cgaatctcaagaactcggccatcagcttct | cagtaatatctcaatgtattgcacaattcc | |||||||
| Mapping_target | Y116A8C | ||||||||
| Type_of_mutation | Deletion | ||||||||
| PCR_product | OK268_external | ||||||||
| OK268_internal | |||||||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00035580 | ||||||||
| Laboratory | RB | ||||||||
| Person | WBPerson46 | ||||||||
| KO_consortium_allele | |||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00006405 | |||||||
| Transcript | Y116A8C.36c.1 (11) | ||||||||
| Y116A8C.36b.1 (11) | |||||||||
| Y116A8C.36a.1 (11) | |||||||||
| Y116A8C.36f.1 (11) | |||||||||
| Y116A8C.36e.1 (11) | |||||||||
| Y116A8C.36d.1 (11) | |||||||||
| Interactor | WBInteraction000538783 | ||||||||
| Isolation | Mutagen | UV/TMP | |||||||
| Description | Phenotype | WBPhenotype:0000016 | Paper_evidence | WBPaper00031112 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | itsn-1(ok268) and itsn-1(tm725) worms were hypersensitive to aldicarb, in acute and chronic assays | Paper_evidence | WBPaper00031112 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Variation_effect | Null | Paper_evidence | WBPaper00031112 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Affected_by | Molecule | WBMol:00003650 | Paper_evidence | WBPaper00031112 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00031112 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0000436 | Paper_evidence | WBPaper00031112 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | Dynamin redistributes, in part, from a soluble to a membrane-bound fraction in an ITSN-1 mutant background | Paper_evidence | WBPaper00031112 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Variation_effect | Null | Paper_evidence | WBPaper00031112 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_assay | Treatment | Western Blots with SNB-1, ITSN-1 and DYN-1 antibodies | Paper_evidence | WBPaper00031112 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0000519 | Paper_evidence | WBPaper00031546 | |||||||
| Curator_confirmed | WBPerson7761 | ||||||||
| Remark | Null mutants are viable and display grossly normal locomotion and development. However, motor neurons in these mutants show a dramatic increase in large irregular vesicles and accumulate membrane-associated vesicles at putative endocytic hotspots, approximately 300 nm from the presynaptic density. | Paper_evidence | WBPaper00031546 | ||||||
| Curator_confirmed | WBPerson7761 | ||||||||
| WBPhenotype:0001323 | Paper_evidence | WBPaper00031546 | |||||||
| Curator_confirmed | WBPerson7761 | ||||||||
| Remark | Null mutants are viable and display grossly normal locomotion and development. However, motor neurons in these mutants show a dramatic increase in large irregular vesicles and accumulate membrane-associated vesicles at putative endocytic hotspots, approximately 300 nm from the presynaptic density. | Paper_evidence | WBPaper00031546 | ||||||
| Curator_confirmed | WBPerson7761 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0005409 | PATO:0000460 | Paper_evidence | WBPaper00031546 | ||||
| Curator_confirmed | WBPerson7761 | ||||||||
| WBPhenotype:0001671 | Paper_evidence | WBPaper00031546 | |||||||
| Curator_confirmed | WBPerson7761 | ||||||||
| Remark | Null mutants are viable and display grossly normal locomotion and development. However, motor neurons in these mutants show a dramatic increase in large irregular vesicles and accumulate membrane-associated vesicles at putative endocytic hotspots, approximately 300 nm from the presynaptic density. | Paper_evidence | WBPaper00031546 | ||||||
| Curator_confirmed | WBPerson7761 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0005409 | PATO:0000460 | Paper_evidence | WBPaper00031546 | ||||
| Curator_confirmed | WBPerson7761 | ||||||||
| Phenotype_not_observed (13) | |||||||||
| Reference | WBPaper00031112 | ||||||||
| WBPaper00031546 | |||||||||
| WBPaper00065262 | |||||||||
| Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
| Method | KO_consortium_allele |
