WormBase Tree Display for Variation: WBVar00091633
expand all nodes | collapse all nodes | view schema
WBVar00091633 | Evidence | Paper_evidence | WBPaper00031602 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ok335 | |||||||
HGVSg | CHROMOSOME_I:g.1843615_1844684del | ||||||||
Sequence_details | SMap | S_parent | Sequence | M01D7 | |||||
Flanking_sequences | taccggccacttcaggtagggaacaagaca | aatcggcaaattgccgatttgtcgaatttg | |||||||
Mapping_target | M01D7 | ||||||||
Type_of_mutation | Deletion | ||||||||
PCR_product | ok335_external | ||||||||
ok335_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00031371 | ||||||||
Laboratory | RB | ||||||||
Person | WBPerson46 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003750 | |||||||
Transcript | M01D7.5.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
Intron_number | 3/4 | ||||||||
Exon_number | 4-5/5 | ||||||||
Isolation | Mutagen | UV/TMP | |||||||
Genetics | Mapping_data | In_multi_point | 4536 | ||||||
Description | Phenotype (20) | ||||||||
Phenotype_not_observed | WBPhenotype:0000124 | Paper_evidence | WBPaper00031602 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Lack of NLP-12 in C. elegans did not affect the in vivo amylase activity | Paper_evidence | WBPaper00031602 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000038 | PATO:0000460 | Paper_evidence | WBPaper00031602 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Animals were subjected to 100 microM BODIPY FL conjugated DQ corn starch for 35 min in the presence of OP50 | Paper_evidence | WBPaper00031602 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000145 | Paper_evidence | WBPaper00031602 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000518 | Paper_evidence | WBPaper00031602 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000634 | Paper_evidence | WBPaper00031602 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | The lack of NLP-12 did not affect the pharyngeal pumping rate | Paper_evidence | WBPaper00031602 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000038 | PATO:0000460 | Paper_evidence | WBPaper00031602 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00031602 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000650 | Paper_evidence | WBPaper00031602 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Lack of NLP-12 did not affect the defecation rate | Paper_evidence | WBPaper00031602 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000038 | PATO:0000460 | Paper_evidence | WBPaper00031602 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00043908 | ||||||||
WBPaper00031602 | |||||||||
WBPaper00062141 | |||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |