WormBase Tree Display for Variation: WBVar00091643
expand all nodes | collapse all nodes | view schema
| WBVar00091643 | Name | Public_name | ok345 | ||
|---|---|---|---|---|---|
| Other_name | F59C12.2a.1:c.1074+427_1415+33delinsCTAGAAATAATTTCCCCCTAATTTC | ||||
| F59C12.2b.1:c.930+427_1271+33delinsCTAGAAATAATTTCCCCCTAATTTC | |||||
| HGVSg | CHROMOSOME_X:g.16584187_16585045delinsCTAGAAATAATTTCCCCCTAATTTC | ||||
| Sequence_details | SMap | S_parent | Sequence | F59C12 | |
| Flanking_sequences | tgttttgtaagctttgtaaaattatgtagt | ccactagaaataatttcccccttctttttc | |||
| Mapping_target | F59C12 | ||||
| Type_of_mutation | Insertion | CTAGAAATAATTTCCCCCTAATTTC | |||
| Deletion | |||||
| PCR_product | OK345_external | ||||
| OK345_internal | |||||
| SeqStatus | Sequenced | ||||
| Variation_type | Allele | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Strain | WBStrain00005588 | ||||
| WBStrain00005591 | |||||
| WBStrain00031373 | |||||
| WBStrain00055572 | |||||
| WBStrain00055575 | |||||
| WBStrain00055576 | |||||
| WBStrain00055579 | |||||
| WBStrain00055580 | |||||
| WBStrain00055581 | |||||
| WBStrain00055583 | |||||
| Laboratory | RB | ||||
| Person | WBPerson46 | ||||
| KO_consortium_allele | |||||
| Status | Live | ||||
| Affects | Gene | WBGene00004776 | |||
| Transcript | F59C12.2a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||
| VEP_impact | HIGH | ||||
| HGVSc | F59C12.2a.1:c.1074+427_1415+33delinsCTAGAAATAATTTCCCCCTAATTTC | ||||
| Intron_number | 3-4/6 | ||||
| Exon_number | 4/7 | ||||
| F59C12.2b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||
| VEP_impact | HIGH | ||||
| HGVSc | F59C12.2b.1:c.930+427_1271+33delinsCTAGAAATAATTTCCCCCTAATTTC | ||||
| Intron_number | 2-3/4 | ||||
| Exon_number | 3/5 | ||||
| Interactor | WBInteraction000517560 | ||||
| WBInteraction000525285 | |||||
| Isolation | Mutagen | UV/TMP | |||
| Description | Phenotype (27) | ||||
| Phenotype_not_observed (11) | |||||
| Reference (16) | |||||
| Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||
| Variation stub/paper connection generated from the May 2021 NN VFP dataset. | |||||
| Created by WBPerson1983 from the NN_VFP_triage_pipeline | |||||
| Created by WBPerson51134 from the NN_VFP_triage_pipeline | |||||
| Method | KO_consortium_allele |
