WormBase Tree Display for Variation: WBVar00091740
expand all nodes | collapse all nodes | view schema
WBVar00091740 | Name | Public_name | ok449 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | F57C7.3b.1:c.153+113_349del | ||||||||
F57C7.3a.1:c.153+113_352del | |||||||||
HGVSg | CHROMOSOME_X:g.10592531_10593013del | ||||||||
Sequence_details | SMap | S_parent | Sequence | F57C7 | |||||
Flanking_sequences | aaaagaaaaagccgacacaaaccgctgtag | CATTTGCCGCGCTTCAGATTCGAGCCTGCT | |||||||
Mapping_target | F57C7 | ||||||||
Type_of_mutation | Deletion | ||||||||
PCR_product | OK449_external | ||||||||
OK449_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00031428 | ||||||||
Laboratory | RB | ||||||||
Person | WBPerson46 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00004749 | |||||||
Transcript (2) | |||||||||
Interactor (2) | |||||||||
Isolation | Mutagen | UV/TMP | |||||||
Genetics | Mapping_data | In_multi_point | 4652 | ||||||
Description | Phenotype | WBPhenotype:0000470 | Paper_evidence | WBPaper00026825 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | HSN neurons either failed to migrate at all or stopped prematurely before reaching their normal position near the vulva | Paper_evidence | WBPaper00026825 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00026825 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00026825 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | mgIs71 | Paper_evidence | WBPaper00026825 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000632 | Paper_evidence | WBPaper00026825 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Severe defasciculation defects | Paper_evidence | WBPaper00026825 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00026825 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005270 | PATO:0000460 | Paper_evidence | WBPaper00026825 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0005303 | PATO:0000460 | Paper_evidence | WBPaper00026825 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | oxIs12 | Paper_evidence | WBPaper00026825 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000699 | Paper_evidence | WBPaper00026825 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Abnormal vulval development | Paper_evidence | WBPaper00026825 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00026825 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006748 | PATO:0000460 | Paper_evidence | WBPaper00026825 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001672 | Paper_evidence | WBPaper00026825 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | In both sdn-1 mutants, the circumferential outgrowth of commissures was impaired | Paper_evidence | WBPaper00026825 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00026825 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005270 | PATO:0000460 | Paper_evidence | WBPaper00026825 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0005303 | PATO:0000460 | Paper_evidence | WBPaper00026825 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | oxIs12 | Paper_evidence | WBPaper00026825 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001761 | Paper_evidence | WBPaper00026825 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Midline crossover defects of PVQL and PVQR, with either contralateral analog inappropriately crossing the midline | Paper_evidence | WBPaper00026825 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00026825 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006976 | PATO:0000460 | Paper_evidence | WBPaper00026825 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | oyIs14 | Paper_evidence | WBPaper00026825 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001767 | Paper_evidence | WBPaper00026825 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | The midline choice (where the axons turn at the midline either to the left or right) is affected. | Paper_evidence | WBPaper00026825 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00026825 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005303 | PATO:0000460 | Paper_evidence | WBPaper00026825 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0005270 | PATO:0000460 | Paper_evidence | WBPaper00026825 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | oxIs12 | Paper_evidence | WBPaper00026825 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_not_observed | WBPhenotype:0000604 | Paper_evidence | WBPaper00026825 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | The nervous system is grossly intact in all mutants | Paper_evidence | WBPaper00026825 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00026825 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | DiI staining | Paper_evidence | WBPaper00026825 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Genotype | oyIs17, zdIs5, otIs39, evIs82b, rhIs4 | Paper_evidence | WBPaper00026825 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001652 | Paper_evidence | WBPaper00032446 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00032446 | ||||||||
WBPaper00026825 | |||||||||
WBPaper00024413 | |||||||||
WBPaper00025474 | |||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |