WormBase Tree Display for Variation: WBVar00091807
expand all nodes | collapse all nodes | view schema
WBVar00091807 | Name (3) | |||||||
---|---|---|---|---|---|---|---|---|
Sequence_details | SMap | S_parent | Sequence | F47D12 | ||||
Flanking_sequences | aaaacttggataccacgtagtagcagacta | ttgatgcggatagtgtatcatcaatggttg | ||||||
Mapping_target | F47D12 | |||||||
Type_of_mutation | Deletion | |||||||
PCR_product | OK520_external | |||||||
OK520_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00031470 | |||||||
Laboratory | RB | |||||||
Person | WBPerson46 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00001518 | ||||||
Transcript | F47D12.1b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | F47D12.1b.1:c.735-461_1093del | |||||||
cDNA_position | ?-1148 | |||||||
CDS_position | ?-1093 | |||||||
Protein_position | ?-365 | |||||||
Intron_number | 6-8/12 | |||||||
Exon_number | 7-9/13 | |||||||
F47D12.1e.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
cDNA_position | ?-625 | |||||||
CDS_position | ?-253 | |||||||
Protein_position | ?-85 | |||||||
Intron_number | 2-3/7 | |||||||
Exon_number | 1-4/8 | |||||||
F47D12.1a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F47D12.1a.1:c.735-461_1093del | |||||||
cDNA_position | ?-1136 | |||||||
CDS_position | ?-1093 | |||||||
Protein_position | ?-365 | |||||||
Intron_number | 6-8/13 | |||||||
Exon_number | 7-9/14 | |||||||
F47D12.1c.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F47D12.1c.1:c.735-461_1093del | |||||||
cDNA_position | ?-1138 | |||||||
CDS_position | ?-1093 | |||||||
Protein_position | ?-365 | |||||||
Intron_number | 6-8/12 | |||||||
Exon_number | 7-9/13 | |||||||
Isolation | Mutagen | UV/TMP | ||||||
Genetics | Mapping_data | In_multi_point | 4334 | |||||
Description | Phenotype (21) | |||||||
Phenotype_not_observed | WBPhenotype:0000001 | Paper_evidence | WBPaper00032008 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | The average A-P curvature was similar among wild type animals, gar-2(-) animals and gar-2(-) animals with GAR-2 overexpressed in cholinergic neurons. | Paper_evidence | WBPaper00032008 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Sensitivity to aldiarb was determined by analyzing the onset of paralysis after treatment with 1mM aldicarb. | Paper_evidence | WBPaper00032008 | ||||
Curator_confirmed | WBPerson712 | |||||||
Genotype | wt or [Punc-17::Venus::GAR-2] | Paper_evidence | WBPaper00032008 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000845 | Paper_evidence | WBPaper00032008 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Muscle sensitivity to levamisole was not altered in the gar-2 mutant compared with wild type. | Paper_evidence | WBPaper00032008 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00004019 | Paper_evidence | WBPaper00032008 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Sensitivity was determined by analyzing the onset of paralysis after treatment with 200uM levamisole. | Paper_evidence | WBPaper00032008 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001012 | Paper_evidence | WBPaper00032196 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals were as susceptible to infection by P. aeruginosa as N2 animals. | Paper_evidence | WBPaper00032196 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Strain | WBStrain00031470 | Paper_evidence | WBPaper00032196 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference (5) | ||||||||
Remark | Last updated on 29 Nov 2002 | |||||||
Knockout originally requested for F47D12.2 before it was renamed to F47D12.1a | ||||||||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |