WormBase Tree Display for Variation: WBVar00091812
expand all nodes | collapse all nodes | view schema
WBVar00091812 | Name | Public_name | ok525 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | C12D8.10b.1:c.762+77_1249del | ||||||||
C12D8.10a.1:c.762+77_1234del | |||||||||
HGVSg | CHROMOSOME_V:g.10250753_10252003del | ||||||||
Sequence_details | SMap | S_parent | Sequence | C12D8 | |||||
Flanking_sequences | acttttgtttaaattttaaccccagcacgt | GCAAGTTGAGTCAAGAAGCTAGAACTTTGC | |||||||
Mapping_target | C12D8 | ||||||||
Type_of_mutation | Deletion | ||||||||
PCR_product | OK525_external | ||||||||
OK525_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00031473 | ||||||||
Component_of_genotype | WBGenotype00000019 | ||||||||
Laboratory | RB | ||||||||
Person | WBPerson46 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000102 | |||||||
Transcript | C12D8.10c.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
Intron_number | 5/5 | ||||||||
Exon_number | 6/6 | ||||||||
C12D8.10b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C12D8.10b.1:c.762+77_1249del | ||||||||
cDNA_position | ?-1300 | ||||||||
CDS_position | ?-1249 | ||||||||
Protein_position | ?-417 | ||||||||
Intron_number | 6-8/10 | ||||||||
Exon_number | 7-9/11 | ||||||||
C12D8.10a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C12D8.10a.1:c.762+77_1234del | ||||||||
cDNA_position | ?-1283 | ||||||||
CDS_position | ?-1234 | ||||||||
Protein_position | ?-412 | ||||||||
Intron_number | 6-8/10 | ||||||||
Exon_number | 7-9/11 | ||||||||
Interactor (17) | |||||||||
Isolation | Mutagen | UV/TMP | |||||||
Description | Phenotype | WBPhenotype:0000061 | Paper_evidence | WBPaper00036474 | |||||
WBPaper00045812 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Both akt-1(ok525) and akt-2(ok393) mutants showed a reproducible increase in lifespan relative to wild type (Fig 3g and Supplementary Table 1)." | Paper_evidence | WBPaper00036474 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
"Mutation in akt-2 exhibited greater lifespan extension of daf-16(mgDf50); daf-16a transgenic animals than a mutation in akt-1 (Fig 3h and Supplementary Table 1)." | Paper_evidence | WBPaper00036474 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
"... consistent with the DAF-16 nuclear translocation data, mutation in akt-1 resulted in a larger increase in lifespan of daf-16(mgDf50); daf-16d/f transgenic animals when compared with a mutation in akt-2 (Fig 3i and Supplementary Table 1)." | Paper_evidence | WBPaper00036474 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Table S1 | Paper_evidence | WBPaper00045812 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | daf-16(mgDf50); DAF-16a::GFP | Paper_evidence | WBPaper00036474 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
daf-16(mgDf50); DAF-16d/f::GFP | Paper_evidence | WBPaper00036474 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000136 | Paper_evidence | WBPaper00029085 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | The levels of both egl-1 and ced-13 transcripts are higher in akt-1 loss-of-function mutants following IR treatment | Paper_evidence | WBPaper00029085 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00029085 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00029085 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | IR treatment | Paper_evidence | WBPaper00029085 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000731 | Paper_evidence | WBPaper00029085 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | akt-1 loss-of-function mutants exhibited increased sensitivity to DNA-damage-induced germ-cell apoptosis 12, 24, and 36 hr after irradiation | Paper_evidence | WBPaper00029085 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00029085 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006796 | PATO:0000460 | Paper_evidence | WBPaper00029085 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00029085 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Treated with 60 Gy IR | Paper_evidence | WBPaper00029085 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001184 | Paper_evidence | WBPaper00035277 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Figure S13d,e | Paper_evidence | WBPaper00035277 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | Animals were stained with Nile red to assess intestinal fat content | Paper_evidence | WBPaper00035277 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001781 | Paper_evidence | WBPaper00029085 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | ENU caused a significant increase in germline apoptosis in akt-1 and akt-2 loss of- function mutants | Paper_evidence | WBPaper00029085 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00029085 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006796 | PATO:0000460 | Paper_evidence | WBPaper00029085 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00029085 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Treated with 5mM ENU | Paper_evidence | WBPaper00029085 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001817 | Paper_evidence | WBPaper00028460 | |||||||
Curator_confirmed | WBPerson1918 | ||||||||
Remark | Animals are defective in learned avoidance of salt concentrations encountered under starvation conditions. | Paper_evidence | WBPaper00028460 | ||||||
Curator_confirmed | WBPerson1918 | ||||||||
WBPhenotype:0001999 | Paper_evidence | WBPaper00037970 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | The integration of signals for attraction to diacetyl (100x dilute) and avoidance from copper (100 millimolar) was impaired in akt-1(ok525) insulin-like signaling pathway mutants, resulting in more animals crossing the copper barrier to get to the diacetyl spot than in wild type controls (Figure 1C) | Paper_evidence | WBPaper00037970 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00002862 | Paper_evidence | WBPaper00037970 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBMol:00002819 | Paper_evidence | WBPaper00037970 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002268 | Paper_evidence | WBPaper00035277 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Figure S13b,c | Paper_evidence | WBPaper00035277 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | Animals were stained with Mitotracker Deep Red 633 to visualize intestinal mitochondria | Paper_evidence | WBPaper00035277 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_not_observed | WBPhenotype:0000436 | Paper_evidence | WBPaper00028886 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | Localization of the synaptic protein SNB-1 is normal, based on transgene analysis with a reporter. | Paper_evidence | WBPaper00028886 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000481 | Paper_evidence | WBPaper00037970 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Mutant animals did not display an abnormal aversion response to copper, compared to wild type animals (Figure 2B) | Paper_evidence | WBPaper00037970 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00002862 | Paper_evidence | WBPaper00037970 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000680 | Paper_evidence | WBPaper00037970 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Mutant animals displayed a wild type response to 1 millimolar aldicarb | Paper_evidence | WBPaper00037970 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00003650 | Paper_evidence | WBPaper00037970 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000730 | Paper_evidence | WBPaper00029085 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | None of the akt mutants affected developmental apoptosis | Paper_evidence | WBPaper00029085 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00029085 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000741 | Paper_evidence | WBPaper00029085 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Germline cell-cycle arrest was not altered in either akt-1 gain-of-function or loss-of-function mutants | Paper_evidence | WBPaper00029085 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00029085 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000885 | Paper_evidence | WBPaper00029085 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | None of the akt mutants affected the engulfment rates of the germ-cell corpses | Paper_evidence | WBPaper00029085 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00029085 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001470 | Paper_evidence | WBPaper00037970 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Mutants exhibited no change in chemotaxis towards diacetyl, compared to wild type controls (Figure 2A) | Paper_evidence | WBPaper00037970 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00002819 | Paper_evidence | WBPaper00037970 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0004023 | Paper_evidence | WBPaper00037970 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Mutant animals exhibit a wild type frequency of body bends (Figure 3A) | Paper_evidence | WBPaper00037970 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference | WBPaper00037970 | ||||||||
WBPaper00028886 | |||||||||
WBPaper00029085 | |||||||||
WBPaper00028460 | |||||||||
WBPaper00036474 | |||||||||
WBPaper00035277 | |||||||||
WBPaper00045812 | |||||||||
WBPaper00065706 | |||||||||
Remark | Last updated on 29 Nov 2002 | ||||||||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||||
Method | KO_consortium_allele |