WormBase Tree Display for Variation: WBVar00091902
expand all nodes | collapse all nodes | view schema
WBVar00091902 | Name | Public_name | ok618 | ||
---|---|---|---|---|---|
Other_name | CE51009:p.Gln601IlefsTer28 | ||||
F45E4.3b.1:c.1801_11407del | |||||
F45E4.3a.1:c.1801_11407del | |||||
CE51026:p.Gln601IlefsTer28 | |||||
HGVSg | CHROMOSOME_IV:g.7591500_7601177del | ||||
Sequence_details | SMap | S_parent | Sequence | Y2C2A | |
Flanking_sequences | GAGCTCCGGTTCATTTTGTCTAACTTGAGGAGTTGGTAGAGTTTGTAGAT | TTCGAATGATGATTGTTCTGCAAGACTCTGGATCCTTGCAATGTGATCAATCTCTTCTTGTGTCAGTTCTGG | |||
Mapping_target | Y2C2A | ||||
Type_of_mutation | Deletion | ||||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00035728 | ||||
Laboratory | RB | ||||
Person | WBPerson46 | ||||
KO_consortium_allele | |||||
Status | Live | Curator_confirmed | WBPerson4025 | ||
Affects | Gene | WBGene00018468 | |||
WBGene00170836 | |||||
Transcript | T23A7.1 | ||||
F45E4.3b.1 (11) | |||||
F45E4.3a.1 (11) | |||||
Isolation | Mutagen | TMP/UV | |||
Remark | This was suppressed because it overlapped with a corrected genome sequence error feature | Feature_evidence | WBsf898558 | ||
This was un-suppressed after examination showed it is not changed by the corrected genome sequence error | Curator_confirmed | WBPerson4025 | |||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |