WormBase Tree Display for Variation: WBVar00091951
expand all nodes | collapse all nodes | view schema
WBVar00091951 | Evidence | Paper_evidence | WBPaper00032009 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ok667 | |||||||
HGVSg | |||||||||
Sequence_details | SMap | S_parent | Sequence | T03G6 | |||||
Flanking_sequences | aaaaatcttgaattctagctatcgaaaaaa | aaaatttaaactttatgaatctattgattt | |||||||
Mapping_target | T03G6 | ||||||||
Type_of_mutation | Insertion | AAAGGTNCCCN | |||||||
Deletion | |||||||||
PCR_product | ok667_external | ||||||||
ok667_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00031553 | ||||||||
Laboratory | RB | ||||||||
Person | WBPerson46 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003630 | |||||||
Transcript | T03G6.2c.1 | VEP_consequence | intron_variant | ||||||
VEP_impact | MODIFIER | ||||||||
Intron_number | 2/13 | ||||||||
T03G6.2b.1 | VEP_consequence | intron_variant | |||||||
VEP_impact | MODIFIER | ||||||||
Intron_number | 2/13 | ||||||||
Interactor | WBInteraction000503695 | ||||||||
Isolation | Mutagen | UV/TMP | |||||||
Genetics | Mapping_data | In_multi_point | 4787 | ||||||
Description | Phenotype | WBPhenotype:0000112 | Paper_evidence | WBPaper00032009 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Several major peaks differed in a comparison of complete chromatograms between control and mutant animals; 50 major peaks were more abundant in control fractions, while 10 major peaks were more abundant in mutant animals. | Paper_evidence | WBPaper00032009 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000119 | Paper_evidence | WBPaper00032009 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | MYO-3 levels are elevated relative to actin when compared to wild type animals. Levels of protein were assayed by Western blot with additional densitometric analysis. | Paper_evidence | WBPaper00032009 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000023 | PATO:0000460 | Paper_evidence | WBPaper00032009 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000134 | Paper_evidence | WBPaper00032009 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Expression levels of muscle genes, unc-95, unc-54, unc-60, unc-97, unc-98, unc-89 and myo-3 were not significantly altered. Levels of other muscle genes, unc-52, myo-2 and act-1 were significantly reduced compared to levels in N2 worms. Levels of myo-1 was mildly reduced. | Paper_evidence | WBPaper00032009 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000023 | PATO:0000460 | Paper_evidence | WBPaper00032009 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00032009 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Low culture temperature dramatically increases the proportion of severely affected larva (n=4291). | Paper_evidence | WBPaper00032009 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000023 | PATO:0000460 | Paper_evidence | WBPaper00032009 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Cold_sensitive | 16 | Paper_evidence | WBPaper00032009 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 16, 20, 24 | Paper_evidence | WBPaper00032009 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001072 | Paper_evidence | WBPaper00032009 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibit a progressively elevated penetrance of phenotypes as the food supply is restricted (n=3044). | Paper_evidence | WBPaper00032009 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000023 | PATO:0000460 | Paper_evidence | WBPaper00032009 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Cold_sensitive | 16 | Paper_evidence | WBPaper00032009 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | To test the effects of food restriction, bacterial suspensions were transferred on plates with the increasing volume so that plates with the following bacterial amounts were prepared: None, 3.3 x 105, 3.3 x 106, 3.3 x 107, and 1.65 x 109. Plates were irradiated on UV transluminator for 2 times 10 min each prior to inoculation of synchronized L1 larvae. | Paper_evidence | WBPaper00032009 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 16, 20, 24 | Paper_evidence | WBPaper00032009 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001569 | Paper_evidence | WBPaper00032009 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibit severely disrupted myosin fibrils as detected by MYO-3 immunocytochemistry. | Paper_evidence | WBPaper00032009 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00032009 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00032009 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Cold_sensitive | 16 | Paper_evidence | WBPaper00032009 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 16, 20, 24 | Paper_evidence | WBPaper00032009 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001644 | Paper_evidence | WBPaper00032009 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | MYO-3 elution profile is altered. | Paper_evidence | WBPaper00032009 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00032009 | ||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |