WormBase Tree Display for Variation: WBVar00092582
expand all nodes | collapse all nodes | view schema
WBVar00092582 | Evidence | Paper_evidence | WBPaper00031872 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ok1357 | |||||||
Other_name | C11E4.3a.1:c.691-194_1090delinsC | ||||||||
HGVSg | CHROMOSOME_X:g.9590754_9591559delinsC | ||||||||
Sequence_details | SMap | S_parent | Sequence | C11E4 | |||||
Flanking_sequences | tggttgttttggattttatagtcgcatact | atgtgtggaatagcgcagaagtcaacgagg | |||||||
Mapping_target | C11E4 | ||||||||
Type_of_mutation | Insertion | C | |||||||
Deletion | |||||||||
PCR_product | ok1357_external | ||||||||
ok1357_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00036103 | ||||||||
Laboratory | RB | ||||||||
Person | WBPerson46 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00007518 | |||||||
WBGene00202031 | |||||||||
Transcript | C11E4.15 | VEP_consequence | transcript_ablation | ||||||
VEP_impact | HIGH | ||||||||
Exon_number | 1/1 | ||||||||
C11E4.3a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C11E4.3a.1:c.691-194_1090delinsC | ||||||||
cDNA_position | ?-1128 | ||||||||
CDS_position | ?-1090 | ||||||||
Protein_position | ?-364 | ||||||||
Intron_number | 6-7/12 | ||||||||
Exon_number | 7-8/13 | ||||||||
Isolation | Mutagen | UV/TMP | |||||||
Genetics | Mapping_data | In_multi_point | 5201 | ||||||
Description | Phenotype | WBPhenotype:0000016 | Paper_evidence | WBPaper00031872 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | % animals paralyzed after 60 min on 1mM aldicarb was significantly higher than % N2 animals paralyzed. | Paper_evidence | WBPaper00031872 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003650 | Paper_evidence | WBPaper00031872 | |||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007833 | PATO:0001549 | Paper_evidence | WBPaper00031872 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000420 | Paper_evidence | WBPaper00031872 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | % animals paralyzed after 60 min on 200mM levamisole was significantly higher than % N2 animals paralyzed under the same conditions. | Paper_evidence | WBPaper00031872 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00004019 | Paper_evidence | WBPaper00031872 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00031872 | ||||||||
WBPaper00065804 | |||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |