WormBase Tree Display for Variation: WBVar00092827
expand all nodes | collapse all nodes | view schema
WBVar00092827 | Name | Public_name | ok1619 | ||
---|---|---|---|---|---|
Other_name | K03A11.2.1:c.-55+593_-31del | ||||
HGVSg | CHROMOSOME_X:g.13068214_13068986del | ||||
Sequence_details | SMap | S_parent | Sequence | K03A11 | |
Flanking_sequences | tcttctatgcttgtccttgcgacgcttctc | gtggacattgggaacaaagcttcagtatta | |||
Mapping_target | K03A11 | ||||
Type_of_mutation | Deletion | ||||
PCR_product | OK1619_external | ||||
OK1619_internal | |||||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00032120 | ||||
Laboratory | RB | ||||
Person | WBPerson46 | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00202486 | |||
WBGene00010520 | |||||
WBGene00200314 | |||||
Transcript | K03A11.7 | VEP_consequence | transcript_ablation | ||
VEP_impact | HIGH | ||||
Exon_number | 1/1 | ||||
K03A11.2.2 | VEP_consequence | 5_prime_UTR_variant | |||
VEP_impact | MODIFIER | ||||
cDNA_position | ?-26 | ||||
Exon_number | 1/5 | ||||
K03A11.9 | VEP_consequence | transcript_ablation | |||
VEP_impact | HIGH | ||||
Exon_number | 1/1 | ||||
K03A11.2.1 | VEP_consequence | splice_acceptor_variant,5_prime_UTR_variant,intron_variant | |||
VEP_impact | HIGH | ||||
HGVSc | K03A11.2.1:c.-55+593_-31del | ||||
cDNA_position | ?-383 | ||||
Intron_number | 2/6 | ||||
Exon_number | 3/7 | ||||
Isolation | Mutagen | EMS | |||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||
Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00010520 Genomic_neighbourhood | |||||
Method | KO_consortium_allele |