WormBase Tree Display for Variation: WBVar00093331
expand all nodes | collapse all nodes | view schema
| WBVar00093331 | Name | Public_name | ok2156 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Other_name | CE06971:p.Ser113LysfsTer11 | ||||||||
| C53B7.1.1:c.337_1329delinsAAACATCGCTACATTT | |||||||||
| HGVSg | CHROMOSOME_X:g.6858840_6860371delinsAAACATCGCTACATTT | ||||||||
| Sequence_details | SMap | S_parent | Sequence | C53B7 | |||||
| Flanking_sequences | aaacatcgcaaaacatcgctacatttctca | gctggatttggtaggaataataattctgaa | |||||||
| Mapping_target | C53B7 | ||||||||
| Type_of_mutation | Insertion | AAACATCGCTACATTT | |||||||
| Deletion | |||||||||
| PCR_product | ok2156_external | ||||||||
| ok2156_internal | |||||||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00032404 | ||||||||
| Laboratory | RB | ||||||||
| Person | WBPerson46 | ||||||||
| KO_consortium_allele | |||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00004370 | |||||||
| Transcript | C53B7.1.1 (11) | ||||||||
| Interactor | WBInteraction000504964 | ||||||||
| WBInteraction000504966 | |||||||||
| Isolation | Mutagen | EMS | |||||||
| Description | Phenotype | WBPhenotype:0000679 | Paper_evidence | WBPaper00058974 | |||||
| Curator_confirmed | WBPerson10038 | ||||||||
| Remark | Quoted from paper: "We analyzed the abundance of GLR-1::GFP puncta along the axon of the AVA neuron and at the cell body near the nerve ring in WT and rig-3 mutants and found a significant increase in GLR-1::GFP levels along the axon and near the nerve ring in rig-3 mutant animals when compared with WT controls (Figure 2B and Figure S1)." | Paper_evidence | WBPaper00058974 | ||||||
| Curator_confirmed | WBPerson10038 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0005842 | PATO:0000460 | Paper_evidence | WBPaper00058974 | ||||
| Curator_confirmed | WBPerson10038 | ||||||||
| Phenotype_assay | Genotype | Prig-3::HA::GLR-1::GFP | Paper_evidence | WBPaper00058974 | |||||
| Curator_confirmed | WBPerson10038 | ||||||||
| WBPhenotype:0001818 | Paper_evidence | WBPaper00058974 | |||||||
| Curator_confirmed | WBPerson10038 | ||||||||
| Remark | Quoted from paper: "Upon testing the activity of AVA, we found that rig-3 mutants show a significant increase in AVA activity when compared with WT control animals (Figure 3, A and B, Figure S2A, and Videos 4 and 5)." | Paper_evidence | WBPaper00058974 | ||||||
| Curator_confirmed | WBPerson10038 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0005842 | PATO:0000460 | Paper_evidence | WBPaper00058974 | ||||
| Curator_confirmed | WBPerson10038 | ||||||||
| Phenotype_assay | Genotype | Prig-3::GCaMP5 | Paper_evidence | WBPaper00058974 | |||||
| Curator_confirmed | WBPerson10038 | ||||||||
| WBPhenotype:0002549 | Paper_evidence | WBPaper00058974 | |||||||
| Curator_confirmed | WBPerson10038 | ||||||||
| Remark | Quoted from paper: "We observed the reversal behavior of rig-3 (ok2156) mutant animals and found a significant increase in the reversal frequency of rig-3 mutant animals when compared to WT control animals (Figure 1 and Videos 1 and 2)." | Paper_evidence | WBPaper00058974 | ||||||
| Curator_confirmed | WBPerson10038 | ||||||||
| Phenotype_assay | Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00058974 | |||||
| Curator_confirmed | WBPerson10038 | ||||||||
| Reference | WBPaper00058974 | ||||||||
| WBPaper00064917 | |||||||||
| Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
| Method | KO_consortium_allele |
