WormBase Tree Display for Variation: WBVar00093360
expand all nodes | collapse all nodes | view schema
WBVar00093360 | Name | Public_name | ok2195 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | CE31454:p.Leu231_Ter407delextTer? | |||||||
C49F5.2.1:c.690_1220del | ||||||||
HGVSg | CHROMOSOME_X:g.11971866_11972973del | |||||||
Sequence_details | SMap | S_parent | Sequence | C49F5 | ||||
Flanking_sequences | ttaaaactgagaaatatacttacaaatttc | tctataatgtcgtcgaacctaacagcttct | ||||||
Mapping_target | C49F5 | |||||||
Type_of_mutation | Deletion | |||||||
PCR_product | ok2195_external | |||||||
ok2195_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00037496 | |||||||
Laboratory | RB | |||||||
Person | WBPerson46 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00008206 | ||||||
Transcript | C49F5.2.1 (11) | |||||||
Isolation | Mutagen | EMS | ||||||
Description | Phenotype | WBPhenotype:0000061 | Paper_evidence | WBPaper00064543 | ||||
Curator_confirmed | WBPerson6615 | |||||||
Remark | Figure3, the depletion of set-6 extends lifespan in daf-2 mutant. | Paper_evidence | WBPaper00064543 | |||||
Curator_confirmed | WBPerson6615 | |||||||
Phenotype_assay | Genotype | daf-2(e1370) | Paper_evidence | WBPaper00064543 | ||||
Curator_confirmed | WBPerson6615 | |||||||
Reference | WBPaper00064543 | |||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |