WormBase Tree Display for Variation: WBVar00094202
expand all nodes | collapse all nodes | view schema
| WBVar00094202 | Name | Public_name | ok3124 | ||||
|---|---|---|---|---|---|---|---|
| Other_name | F32E10.5.1:c.578-564_578-191del | ||||||
| F32E10.2.2:c.-6-61_234del | |||||||
| HGVSg | CHROMOSOME_IV:g.7576120_7576493del | ||||||
| Sequence_details | SMap | S_parent | Sequence | F32E10 | |||
| Flanking_sequences | ggatgtgtgcacgtctattcgattcatcga | caatctgatgatagcagcggaggtaatttt | |||||
| Mapping_target | F32E10 | ||||||
| Type_of_mutation | Deletion | ||||||
| PCR_product | ok3124_external | ||||||
| ok3124_internal | |||||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00032979 | ||||||
| WBStrain00050681 | |||||||
| WBStrain00050687 | |||||||
| WBStrain00050688 | |||||||
| WBStrain00051706 | |||||||
| WBStrain00053675 | |||||||
| WBStrain00053676 | |||||||
| WBStrain00054542 | |||||||
| WBStrain00054543 | |||||||
| Laboratory | RB | ||||||
| Person | WBPerson46 | ||||||
| KO_consortium_allele | |||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00017992 | |||||
| WBGene00017990 | |||||||
| Transcript | F32E10.2.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | F32E10.2.2:c.-6-61_234del | ||||||
| cDNA_position | ?-381 | ||||||
| CDS_position | ?-234 | ||||||
| Protein_position | ?-78 | ||||||
| Intron_number | 1-3/6 | ||||||
| Exon_number | 2-4/7 | ||||||
| F32E10.2.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||
| VEP_impact | HIGH | ||||||
| cDNA_position | ?-240 | ||||||
| CDS_position | ?-234 | ||||||
| Protein_position | ?-78 | ||||||
| Intron_number | 2/5 | ||||||
| Exon_number | 1-3/6 | ||||||
| F32E10.5.1 | VEP_consequence | intron_variant | |||||
| VEP_impact | MODIFIER | ||||||
| HGVSc | F32E10.5.1:c.578-564_578-191del | ||||||
| Intron_number | 4/7 | ||||||
| Isolation | Mutagen | EMS | |||||
| Description | Phenotype | WBPhenotype:0001348 | Paper_evidence | WBPaper00059355 | |||
| Curator_confirmed | WBPerson401 | ||||||
| Remark | Chromosome compaction and intermixing of compartments for chromosome V in embryos | Paper_evidence | WBPaper00059355 | ||||
| Curator_confirmed | WBPerson401 | ||||||
| WBPhenotype:0002636 | Paper_evidence | WBPaper00048885 | |||||
| Curator_confirmed | WBPerson14737 | ||||||
| Remark | Figure 1E and Figure 5A-B delocalization of heterochromatic reporter and chromosome arms, respectively; Detachment of H3K9 methylated chromatin from nuclear periphery in early embryos | Paper_evidence | WBPaper00048885 | ||||
| Curator_confirmed | WBPerson14737 | ||||||
| Phenotype_not_observed | WBPhenotype:0000050 | Paper_evidence | WBPaper00048885 | ||||
| Curator_confirmed | WBPerson14737 | ||||||
| WBPhenotype:0000054 | Paper_evidence | WBPaper00059355 | |||||
| Curator_confirmed | WBPerson401 | ||||||
| WBPhenotype:0000059 | Paper_evidence | WBPaper00059355 | |||||
| Curator_confirmed | WBPerson401 | ||||||
| WBPhenotype:0000062 | Paper_evidence | WBPaper00059355 | |||||
| Curator_confirmed | WBPerson401 | ||||||
| WBPhenotype:0000824 | Paper_evidence | WBPaper00059355 | |||||
| Curator_confirmed | WBPerson401 | ||||||
| WBPhenotype:0008001 | Paper_evidence | WBPaper00059355 | |||||
| Curator_confirmed | WBPerson401 | ||||||
| Disease_info | Modifies_disease | DOID:11726 | |||||
| Modifies_disease_in_annotation | WBDOannot00000948 | ||||||
| Reference | WBPaper00048885 | ||||||
| WBPaper00059355 | |||||||
| WBPaper00065293 | |||||||
| Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||
| Method | KO_consortium_allele |
