WormBase Tree Display for Variation: WBVar00094701
expand all nodes | collapse all nodes | view schema
WBVar00094701 | Evidence | Paper_evidence | WBPaper00004544 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | or207 | |||||||
Other_name | or207ts | ||||||||
B0207.4.1:c.794C>T | |||||||||
CE24761:p.Pro265Leu | |||||||||
B0207.4.2:c.794C>T | |||||||||
HGVSg | CHROMOSOME_I:g.5938465C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | B0207 | |||||
Flanking_sequences | atttgattggaagattgcttgtcgttgatc | caaggctcgctgtacgcttgaacaggtttg | |||||||
Mapping_target | B0207 | ||||||||
Type_of_mutation | Substitution | c | t | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00007296 | ||||||||
WBStrain00007300 | |||||||||
Laboratory | EU | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000099 | |||||||
Transcript | B0207.4.1 (12) | ||||||||
B0207.4.2 (12) | |||||||||
Interactor | WBInteraction000050631 | ||||||||
WBInteraction000050632 | |||||||||
WBInteraction000050633 | |||||||||
WBInteraction000051383 | |||||||||
WBInteraction000051730 | |||||||||
WBInteraction000557582 | |||||||||
WBInteraction000557584 | |||||||||
WBInteraction000557585 | |||||||||
WBInteraction000557586 | |||||||||
Genetics | Interpolated_map_position | I | 0.482562 | ||||||
Description | Phenotype | WBPhenotype:0000050 | Paper_evidence | WBPaper00032264 | |||||
WBPaper00032269 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Remark | When shifted to restrictive temperatures, air-2(or207ts) hermaphrodites produce dead polyploid one-cell embryos | Paper_evidence | WBPaper00032264 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00032264 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Heat_sensitive | 25C | Paper_evidence | WBPaper00032264 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
20 | Paper_evidence | WBPaper00032269 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000436 | Paper_evidence | WBPaper00032264 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | The mutant AIR-2 protein fails to dissociate from anaphase chromosomes and localize to the spindle midzone and midbody | Paper_evidence | WBPaper00032264 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Heat_sensitive | 25C | Paper_evidence | WBPaper00032264 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Staining with DAPI and anti- AIR-2 antibody | Paper_evidence | WBPaper00032264 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001351 | Paper_evidence | WBPaper00032264 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Aurora A and B autophosphorylation and kinase activation is reduced in air-2 mutants | Paper_evidence | WBPaper00032264 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Heat_sensitive | 25C | Paper_evidence | WBPaper00032264 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Staining with phospho-specific pAurora antibody | Paper_evidence | WBPaper00032264 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001378 | Paper_evidence | WBPaper00032264 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Gross defects in mitotic chromosome segregation | Paper_evidence | WBPaper00032264 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Heat_sensitive | 25C | Paper_evidence | WBPaper00032264 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Staining with DAPI and anti-tubulin antibody | Paper_evidence | WBPaper00032264 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0002408 | Paper_evidence | WBPaper00042416 | |||||||
Curator_confirmed | WBPerson3249 | ||||||||
EQ_annotations | GO_term | GO:0000910 | PATO:0000460 | Paper_evidence | WBPaper00042416 | ||||
Curator_confirmed | WBPerson3249 | ||||||||
Phenotype_not_observed | WBPhenotype:0000313 | Paper_evidence | WBPaper00032269 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Cytological analysis of DAPI-stained germlines from mutant worms revealed six bivalents like that observed in wild type. | Paper_evidence | WBPaper00032269 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00032269 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001175 | Paper_evidence | WBPaper00032269 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 20 | Paper_evidence | WBPaper00032269 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00032264 | ||||||||
WBPaper00032269 | |||||||||
WBPaper00042416 | |||||||||
WBPaper00045580 | |||||||||
Remark | Codon 265 of the air-2 gene was mutated from CCC to CTC in or207ts [030409 ck1] | ||||||||
Method | Substitution_allele |