WormBase Tree Display for Variation: WBVar00142933
expand all nodes | collapse all nodes | view schema
WBVar00142933 | Evidence | Paper_evidence | WBPaper00002646 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e49 | |||||||
Other_name (9) | |||||||||
HGVSg | CHROMOSOME_IV:g.7202315G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | R13A1 | |||||
Flanking_sequences | ctaccatctgaagagcatagacattgtaat | cgaagtcaaaaattgatcgttagttttttt | |||||||
Mapping_target | R13A1 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00002646 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004085 | ||||||||
WBStrain00006265 | |||||||||
WBStrain00006267 | |||||||||
WBStrain00026634 | |||||||||
WBStrain00026871 | |||||||||
WBStrain00026874 | |||||||||
WBStrain00026936 | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects (2) | |||||||||
Genetics | Interpolated_map_position | IV | 3.29389 | ||||||
Mapping_data | In_2_point | 107 | |||||||
In_multi_point (24) | |||||||||
In_pos_neg_data | 2737 | ||||||||
3701 | |||||||||
5318 | |||||||||
Description | Phenotype | WBPhenotype:0000002 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | kinks both forward and backward | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00000031 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson712 | |||||||||
Remark | Moves well but slowly and irregularly, e49/+ very slightly uncoordinated. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES2_Difficult_to_score (2) | ||||||||
WBPhenotype:0001331 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | swollen ventral cord motor neurons | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005829 | PATO:0000460 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (12) | |||||||||
Remark | n49 is a typo of e49 | Paper_evidence | WBPaper00043983 | ||||||
Method | Substitution_allele |