WormBase Tree Display for Variation: WBVar00143019
expand all nodes | collapse all nodes | view schema
WBVar00143019 | Evidence | Paper_evidence | WBPaper00005152 | |||||
---|---|---|---|---|---|---|---|---|
WBPaper00005325 | ||||||||
Name | Public_name | e185 | ||||||
Other_name | CE54061:p.Cys185Tyr | |||||||
F48E8.1a.1:c.554G>A | ||||||||
F48E8.1c.1:c.554G>A | ||||||||
CE01953:p.Cys185Tyr | ||||||||
F48E8.1b.1:c.554G>A | ||||||||
CE29046:p.Cys185Tyr | ||||||||
HGVSg | CHROMOSOME_III:g.5476405G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | F48E8 | ||||
Flanking_sequences | ttgtctgggcaaagacgaatctcgtcggat | cggcttctcccgttgccgtgacgttcaggg | ||||||
Mapping_target | F48E8 | |||||||
Type_of_mutation | Substitution | g | a | |||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain (17) | ||||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects (3) | ||||||||
Genetics | Interpolated_map_position | III | -1.62777 | |||||
Mapping_data | In_2_point | 276 | ||||||
579 | ||||||||
2725 | ||||||||
3796 | ||||||||
3797 | ||||||||
5516 | ||||||||
6014 | ||||||||
7160 | ||||||||
In_multi_point (62) | ||||||||
In_pos_neg_data | 803 | |||||||
1590 | ||||||||
Description | Phenotype (7) | |||||||
Phenotype_not_observed | WBPhenotype:0000505 | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Males are not Ram. | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | |||||||
EQ_annotations (2) | ||||||||
Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00001328 | ||||
Curator_confirmed | WBPerson712 | |||||||
Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001184 | Paper_evidence | WBPaper00032966 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Abnormally sized mutants did not display enhanced fat accumulation | Paper_evidence | WBPaper00032966 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Treatment | Nile Red staining | Paper_evidence | WBPaper00032966 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Reference (12) | ||||||||
Remark | Variation stub/paper connection generated from the May 2021 NN VFP dataset. | |||||||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | ||||||||
Method | Substitution_allele |