WormBase Tree Display for Variation: WBVar00143019
expand all nodes | collapse all nodes | view schema
WBVar00143019 | Evidence | Paper_evidence | WBPaper00005152 | ||||||
---|---|---|---|---|---|---|---|---|---|
WBPaper00005325 | |||||||||
Name | Public_name | e185 | |||||||
Other_name | CE54061:p.Cys185Tyr | ||||||||
F48E8.1a.1:c.554G>A | |||||||||
F48E8.1c.1:c.554G>A | |||||||||
CE01953:p.Cys185Tyr | |||||||||
F48E8.1b.1:c.554G>A | |||||||||
CE29046:p.Cys185Tyr | |||||||||
HGVSg | CHROMOSOME_III:g.5476405G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | F48E8 | |||||
Flanking_sequences | ttgtctgggcaaagacgaatctcgtcggat | cggcttctcccgttgccgtgacgttcaggg | |||||||
Mapping_target | F48E8 | ||||||||
Type_of_mutation | Substitution | g | a | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (17) | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects (3) | |||||||||
Genetics (2) | |||||||||
Description | Phenotype | WBPhenotype:0000022 | Paper_evidence | WBPaper00000031 | |||||
WBPaper00000906 | |||||||||
WBPaper00003454 | |||||||||
WBPaper00005747 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson712 | |||||||||
WBPerson2987 | |||||||||
Remark | about 50% longer than wildtype at all stages, markedly tapering tail and head | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Table 1 | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Recessive | Paper_evidence | WBPaper00000906 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Ease_of_scoring | ES3_Easy_to_score (2) | ||||||||
WBPhenotype:0000342 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Male bursa elongated. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000370 | Paper_evidence | WBPaper00053410 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson3569 | |||||||||
Remark | Eggs elongated. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Figure 2, S1 | Paper_evidence | WBPaper00053410 | |||||||
Curator_confirmed | WBPerson3569 | ||||||||
WBPhenotype:0000961 | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 1 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001412 | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Authors report "multiple or discontinuous ala" (Table 1) | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001517 | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Authors report "abnormal branched annuli (lateral hypodermis)" and "wide annuli" (Table 1) | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002117 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | low penetrance tendency to form constriction behind head, may result in auto-decapitation | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000505 | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Males are not Ram. | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006941 | PATO:0000460 | Paper_evidence | WBPaper00001328 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001184 | Paper_evidence | WBPaper00032966 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Abnormally sized mutants did not display enhanced fat accumulation | Paper_evidence | WBPaper00032966 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Nile Red staining | Paper_evidence | WBPaper00032966 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference (12) | |||||||||
Remark | Variation stub/paper connection generated from the May 2021 NN VFP dataset. | ||||||||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | |||||||||
Method | Substitution_allele |