WormBase Tree Display for Variation: WBVar00143019
expand all nodes | collapse all nodes | view schema
WBVar00143019 | Evidence | Paper_evidence | WBPaper00005152 | |||||
---|---|---|---|---|---|---|---|---|
WBPaper00005325 | ||||||||
Name (3) | ||||||||
Sequence_details | SMap | S_parent | Sequence | F48E8 | ||||
Flanking_sequences | ttgtctgggcaaagacgaatctcgtcggat | cggcttctcccgttgccgtgacgttcaggg | ||||||
Mapping_target | F48E8 | |||||||
Type_of_mutation | Substitution | g | a | |||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain (17) | ||||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00003055 | ||||||
Transcript | F48E8.1b.1 (12) | |||||||
F48E8.1c.1 (12) | ||||||||
F48E8.1a.1 (12) | ||||||||
Interactor | WBInteraction000009116 | |||||||
WBInteraction000503035 | ||||||||
WBInteraction000537301 | ||||||||
Genetics | Interpolated_map_position | III | -1.62777 | |||||
Mapping_data | In_2_point | 276 | ||||||
579 | ||||||||
2725 | ||||||||
3796 | ||||||||
3797 | ||||||||
5516 | ||||||||
6014 | ||||||||
7160 | ||||||||
In_multi_point (62) | ||||||||
In_pos_neg_data | 803 | |||||||
1590 | ||||||||
Description | Phenotype | WBPhenotype:0000022 | Paper_evidence | WBPaper00000031 | ||||
WBPaper00000906 | ||||||||
WBPaper00003454 | ||||||||
WBPaper00005747 | ||||||||
Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson48 | |||||||
WBPerson712 | ||||||||
WBPerson2987 | ||||||||
Remark | about 50% longer than wildtype at all stages, markedly tapering tail and head | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Table 1 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Recessive | Paper_evidence | WBPaper00000906 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Ease_of_scoring | ES3_Easy_to_score (2) | |||||||
WBPhenotype:0000342 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Male bursa elongated. | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000370 | Paper_evidence | WBPaper00053410 | ||||||
Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | |||||||
WBPerson3569 | ||||||||
Remark | Eggs elongated. | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Figure 2, S1 | Paper_evidence | WBPaper00053410 | ||||||
Curator_confirmed | WBPerson3569 | |||||||
WBPhenotype:0000961 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Table 1 | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001412 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Authors report "multiple or discontinuous ala" (Table 1) | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001517 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Authors report "abnormal branched annuli (lateral hypodermis)" and "wide annuli" (Table 1) | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002117 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | low penetrance tendency to form constriction behind head, may result in auto-decapitation | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000505 | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Males are not Ram. | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | |||||||
EQ_annotations (2) | ||||||||
Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00001328 | ||||
Curator_confirmed | WBPerson712 | |||||||
Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001184 | Paper_evidence | WBPaper00032966 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Abnormally sized mutants did not display enhanced fat accumulation | Paper_evidence | WBPaper00032966 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Treatment | Nile Red staining | Paper_evidence | WBPaper00032966 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Reference (12) | ||||||||
Remark | Variation stub/paper connection generated from the May 2021 NN VFP dataset. | |||||||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | ||||||||
Method | Substitution_allele |