WormBase Tree Display for Variation: WBVar00143019
expand all nodes | collapse all nodes | view schema
| WBVar00143019 | Evidence | Paper_evidence | WBPaper00005152 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| WBPaper00005325 | |||||||||
| Name | Public_name | e185 | |||||||
| Other_name | CE54061:p.Cys185Tyr | ||||||||
| F48E8.1a.1:c.554G>A | |||||||||
| F48E8.1c.1:c.554G>A | |||||||||
| CE01953:p.Cys185Tyr | |||||||||
| F48E8.1b.1:c.554G>A | |||||||||
| CE29046:p.Cys185Tyr | |||||||||
| HGVSg | CHROMOSOME_III:g.5476405G>A | ||||||||
| Sequence_details | SMap | S_parent | Sequence | F48E8 | |||||
| Flanking_sequences | ttgtctgggcaaagacgaatctcgtcggat | cggcttctcccgttgccgtgacgttcaggg | |||||||
| Mapping_target | F48E8 | ||||||||
| Type_of_mutation | Substitution | g | a | ||||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain (17) | |||||||||
| Laboratory | CB | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00003055 | |||||||
| Transcript | F48E8.1b.1 (12) | ||||||||
| F48E8.1c.1 (12) | |||||||||
| F48E8.1a.1 (12) | |||||||||
| Interactor | WBInteraction000009116 | ||||||||
| WBInteraction000503035 | |||||||||
| WBInteraction000537301 | |||||||||
| Genetics | Interpolated_map_position | III | -1.62777 | ||||||
| Mapping_data | In_2_point | 276 | |||||||
| 579 | |||||||||
| 2725 | |||||||||
| 3796 | |||||||||
| 3797 | |||||||||
| 5516 | |||||||||
| 6014 | |||||||||
| 7160 | |||||||||
| In_multi_point (62) | |||||||||
| In_pos_neg_data | 803 | ||||||||
| 1590 | |||||||||
| Description | Phenotype (7) | ||||||||
| Phenotype_not_observed | WBPhenotype:0000505 | Paper_evidence | WBPaper00001328 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Males are not Ram. | Paper_evidence | WBPaper00001328 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0006941 | PATO:0000460 | Paper_evidence | WBPaper00001328 | ||||
| Curator_confirmed | WBPerson712 | ||||||||
| Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001328 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00001328 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001184 | Paper_evidence | WBPaper00032966 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | Abnormally sized mutants did not display enhanced fat accumulation | Paper_evidence | WBPaper00032966 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_assay | Treatment | Nile Red staining | Paper_evidence | WBPaper00032966 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Reference (12) | |||||||||
| Remark | Variation stub/paper connection generated from the May 2021 NN VFP dataset. | ||||||||
| Created by WBPerson51134 from the NN_VFP_triage_pipeline | |||||||||
| Method | Substitution_allele |
