WormBase Tree Display for Variation: WBVar00143154
expand all nodes | collapse all nodes | view schema
WBVar00143154 | Evidence | Paper_evidence | WBPaper00002050 | |
---|---|---|---|---|
Name | Public_name | e369 | ||
Other_name | Y60A3A.1.1:c.-2G>A | |||
HGVSg | CHROMOSOME_V:g.20004422C>T | |||
Sequence_details (5) | ||||
Variation_type | Allele | |||
Origin | Species | Caenorhabditis elegans | ||
Strain (21) | ||||
Laboratory | CB | |||
DCD | ||||
Status | Live | |||
Affects (3) | ||||
Genetics | Interpolated_map_position | V | 24.4355 | |
Mapping_data | In_2_point | 137 | ||
254 | ||||
849 | ||||
3379 | ||||
3380 | ||||
6116 | ||||
6128 | ||||
7012 | ||||
7165 | ||||
In_multi_point (22) | ||||
In_pos_neg_data | 298 | |||
2143 | ||||
Description (2) | ||||
Reference (25) | ||||
Remark | e369 is a coupled mutation. In addition to the curated lesion there is a CAG to TAG substitution with flanking sequences agccgacgattcatgagaatgagccgttgg taatgcaaagtatcagcagacggatgttaa | Paper_evidence | WBPaper00002050 | |
Method | Substitution_allele |