WormBase Tree Display for Variation: WBVar00143154
expand all nodes | collapse all nodes | view schema
WBVar00143154 | Evidence | Paper_evidence | WBPaper00002050 | ||
---|---|---|---|---|---|
Name | Public_name | e369 | |||
Other_name | Y60A3A.1.1:c.-2G>A | ||||
HGVSg | CHROMOSOME_V:g.20004422C>T | ||||
Sequence_details (5) | |||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain (21) | |||||
Laboratory (2) | |||||
Status | Live | ||||
Affects | Gene | WBGene00006786 | |||
Transcript | Y60A3A.1.1 | VEP_consequence | 5_prime_UTR_variant | ||
VEP_impact | MODIFIER | ||||
HGVSc | Y60A3A.1.1:c.-2G>A | ||||
cDNA_position | 64 | ||||
Exon_number | 1/11 | ||||
Interactor (21) | |||||
Genetics | Interpolated_map_position | V | 24.4355 | ||
Mapping_data | In_2_point | 137 | |||
254 | |||||
849 | |||||
3379 | |||||
3380 | |||||
6116 | |||||
6128 | |||||
7012 | |||||
7165 | |||||
In_multi_point (22) | |||||
In_pos_neg_data | 298 | ||||
2143 | |||||
Description | Phenotype (19) | ||||
Phenotype_not_observed (8) | |||||
Reference (25) | |||||
Remark | e369 is a coupled mutation. In addition to the curated lesion there is a CAG to TAG substitution with flanking sequences agccgacgattcatgagaatgagccgttgg taatgcaaagtatcagcagacggatgttaa | Paper_evidence | WBPaper00002050 | ||
Method | Substitution_allele |