WormBase Tree Display for Variation: WBVar00143154
expand all nodes | collapse all nodes | view schema
WBVar00143154 | Evidence | Paper_evidence | WBPaper00002050 | ||||
---|---|---|---|---|---|---|---|
Name (3) | |||||||
Sequence_details (5) | |||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain (21) | |||||||
Laboratory | CB | ||||||
DCD | |||||||
Status | Live | ||||||
Affects | Gene | WBGene00006786 | |||||
Transcript | Y60A3A.1.1 | VEP_consequence | 5_prime_UTR_variant | ||||
VEP_impact | MODIFIER | ||||||
HGVSc | Y60A3A.1.1:c.-2G>A | ||||||
cDNA_position | 64 | ||||||
Exon_number | 1/11 | ||||||
Interactor (21) | |||||||
Genetics | Interpolated_map_position | V | 24.4355 | ||||
Mapping_data (3) | |||||||
Description | Phenotype (19) | ||||||
Phenotype_not_observed | WBPhenotype:0000062 | Paper_evidence | WBPaper00038332 | ||||
Curator_confirmed | WBPerson712 | ||||||
Remark | lf mutations in unc-51 led to viable adults. | Paper_evidence | WBPaper00038332 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000306 | Paper_evidence | WBPaper00041269 | |||||
Curator_confirmed | WBPerson2987 | ||||||
Remark | "To confirm that the autophagy pathway was not a major means of CPL-1(W32A;Y35A)::YFP disposal, we crossed Pnhx-2::cpl-1(W32A;Y35A)::YFP animals with an unc-51(e369) knockout strain to yield unc-51(e369);P-nhx-2::CPL-1(W32A;Y35A)::YFP; Pmyo-2::mCherry animals. Two independent lines were analyzed, and showed no significant differences in the level of CPL-1(W32A;Y35A)::YFP, as compared to the controls (Figure 6B)." | Paper_evidence | WBPaper00041269 | ||||
Curator_confirmed | WBPerson2987 | ||||||
WBPhenotype:0000436 | Paper_evidence | WBPaper00028886 | |||||
Curator_confirmed | WBPerson48 | ||||||
Remark | Localization of the synaptic protein SNB-1 is normal, based on expression analysis of SNB-1::VENUS. | Paper_evidence | WBPaper00028886 | ||||
Curator_confirmed | WBPerson48 | ||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00038332 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | lf mutations in unc-51 led to fertile | Paper_evidence | WBPaper00038332 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000885 | Paper_evidence | WBPaper00050047 | |||||
Curator_confirmed | WBPerson7492 | ||||||
Remark | midbody phagocytosis normal | Paper_evidence | WBPaper00050047 | ||||
Curator_confirmed | WBPerson7492 | ||||||
WBPhenotype:0001645 | Paper_evidence | WBPaper00040284 | |||||
Curator_confirmed | WBPerson2987 | ||||||
Remark | Table 1 | Paper_evidence | WBPaper00040284 | ||||
Curator_confirmed | WBPerson2987 | ||||||
WBPhenotype:0001652 | Paper_evidence | WBPaper00032446 | |||||
Curator_confirmed | WBPerson2021 | ||||||
WBPhenotype:0001846 | Paper_evidence | WBPaper00050047 | |||||
Curator_confirmed | WBPerson7492 | ||||||
Remark | midbody phagosome maturation normal | Paper_evidence | WBPaper00050047 | ||||
Curator_confirmed | WBPerson7492 | ||||||
Reference (25) | |||||||
Remark | e369 is a coupled mutation. In addition to the curated lesion there is a CAG to TAG substitution with flanking sequences agccgacgattcatgagaatgagccgttgg taatgcaaagtatcagcagacggatgttaa | Paper_evidence | WBPaper00002050 | ||||
Method | Substitution_allele |